Incidental Mutation 'R8881:Erbb4'
ID676887
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8881 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 68343838 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably benign
Transcript: ENSMUST00000119142
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121473
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121473
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153432
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,475,571 C612Y probably benign Het
Adam21 T C 12: 81,559,876 T371A probably benign Het
Akap9 T C 5: 3,961,279 S661P Het
Anxa11 C T 14: 25,874,263 R233C probably damaging Het
Capza3 A C 6: 140,041,795 D40A probably damaging Het
Caskin1 C A 17: 24,499,299 N294K probably damaging Het
Cdh1 T C 8: 106,666,272 V796A probably benign Het
Cped1 A T 6: 22,119,579 T346S possibly damaging Het
Crisp4 A T 1: 18,115,678 V278D probably damaging Het
Ddx60 A C 8: 62,021,309 D1477A possibly damaging Het
Dmrtb1 T C 4: 107,680,725 D82G possibly damaging Het
Dnah11 T C 12: 118,113,912 N1282S probably benign Het
Dnah11 C T 12: 118,126,815 V1104M probably benign Het
Dot1l A G 10: 80,785,595 E630G probably damaging Het
Dppa4 C A 16: 48,287,936 T28K Het
Dusp5 T A 19: 53,541,314 S383T probably benign Het
Eef2k C T 7: 120,873,325 A87V probably damaging Het
Epha1 T C 6: 42,361,027 Y828C probably damaging Het
Fam151b T A 13: 92,468,122 M120L probably benign Het
Fez2 T C 17: 78,381,622 D366G probably damaging Het
Frmd4b G T 6: 97,295,774 H886N probably benign Het
Galnt17 T C 5: 130,877,797 H511R probably benign Het
Gm8773 A C 5: 5,575,379 D25A possibly damaging Het
Grpel1 C A 5: 36,469,472 Q33K possibly damaging Het
Gzmm A C 10: 79,694,985 probably null Het
Hmcn1 C A 1: 150,649,972 L3333F probably damaging Het
Il21r A T 7: 125,632,326 T309S probably benign Het
Itgal G A 7: 127,330,369 V1153M probably benign Het
Kdf1 G A 4: 133,530,343 A390T possibly damaging Het
Lcn11 G T 2: 25,779,284 R151L probably benign Het
Lgi3 T A 14: 70,532,842 Y116N probably damaging Het
Llgl2 A G 11: 115,853,040 H731R probably benign Het
Lrp5 A T 19: 3,591,015 S1482T probably damaging Het
Meis2 T C 2: 116,058,635 D212G probably benign Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
Mrgprf A G 7: 145,308,262 H187R probably benign Het
Mvd A G 8: 122,437,825 probably null Het
Neb T C 2: 52,206,987 I4938M possibly damaging Het
Nipal4 A T 11: 46,151,350 M168K probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Nrxn2 T C 19: 6,504,890 I1133T probably benign Het
Numa1 T C 7: 102,001,477 Y1472H probably benign Het
Olfr1329 A G 4: 118,917,374 V31A probably benign Het
Olfr1380 G A 11: 49,564,382 V154M probably benign Het
Olfr411 T C 11: 74,346,645 D313G probably benign Het
Olfr530 A G 7: 140,372,785 V275A probably benign Het
Olfr652 A G 7: 104,564,412 M64V possibly damaging Het
Pcdha6 G T 18: 36,968,431 V226F probably damaging Het
Pnpla6 G A 8: 3,531,489 M605I probably benign Het
Ppp1r13l G A 7: 19,371,269 R322H probably damaging Het
Sgtb T C 13: 104,121,538 probably null Het
Skint6 T C 4: 112,815,519 K1086E possibly damaging Het
Slc4a11 T C 2: 130,685,537 E646G probably damaging Het
Speg G T 1: 75,401,151 R851L possibly damaging Het
Spns3 T G 11: 72,539,086 D172A probably damaging Het
Srgap3 A G 6: 112,723,137 V984A probably benign Het
Syne1 A T 10: 5,273,639 D3080E probably damaging Het
Taf5l T C 8: 124,003,362 H196R possibly damaging Het
Tmem229a G C 6: 24,955,588 R56G probably damaging Het
Tmprss6 A C 15: 78,443,787 *582G probably null Het
Trip13 C A 13: 73,929,676 R173L possibly damaging Het
Trpm7 A T 2: 126,819,963 V1055E probably damaging Het
Utrn A G 10: 12,547,993 I2T possibly damaging Het
V1rd19 T A 7: 24,003,656 S182R possibly damaging Het
Vmn2r58 C A 7: 41,837,185 G762V probably benign Het
Wdr66 C T 5: 123,324,375 P1249L probably damaging Het
Zfp874b T C 13: 67,474,022 K386E probably damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
earthworm UTSW 1 68250580 missense possibly damaging 0.67
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4012:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
R7923:Erbb4 UTSW 1 68259209 missense probably damaging 1.00
R8071:Erbb4 UTSW 1 68396311 missense probably damaging 1.00
R8288:Erbb4 UTSW 1 68298350 missense probably damaging 1.00
R8356:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8456:Erbb4 UTSW 1 68071630 missense probably damaging 1.00
R8464:Erbb4 UTSW 1 68309626 missense probably benign
R8783:Erbb4 UTSW 1 68040172 missense possibly damaging 0.95
R8830:Erbb4 UTSW 1 68075468 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTAGCTAATCCCACTGGCC -3'
(R):5'- ATGTATGTGGTTCAGAGGAAGAGTC -3'

Sequencing Primer
(F):5'- GATCTCTGTGAGTTCTAGACCAGAC -3'
(R):5'- TGTGGTTCAGAGGAAGAGTCATAAAC -3'
Posted On2021-07-15