Incidental Mutation 'R8881:Capza3'
ID 676909
Institutional Source Beutler Lab
Gene Symbol Capza3
Ensembl Gene ENSMUSG00000041791
Gene Name capping actin protein of muscle Z-line subunit alpha 3
Synonyms Tex8, repro32, cp alpha3, Gsg3, Cappa3, 510-4
MMRRC Submission 068749-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8881 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 139987283-139988563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 139987521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 40 (D40A)
Ref Sequence ENSEMBL: ENSMUSP00000038562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032356] [ENSMUST00000043797] [ENSMUST00000129986] [ENSMUST00000137148] [ENSMUST00000149931]
AlphaFold P70190
Predicted Effect probably benign
Transcript: ENSMUST00000032356
SMART Domains Protein: ENSMUSP00000032356
Gene: ENSMUSG00000030230

DomainStartEndE-ValueType
Pfam:EF-hand_like 80 162 9.6e-26 PFAM
PLCXc 163 307 5.17e-72 SMART
low complexity region 374 385 N/A INTRINSIC
PLCYc 386 502 1.52e-51 SMART
C2 521 625 2.06e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043797
AA Change: D40A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038562
Gene: ENSMUSG00000041791
AA Change: D40A

DomainStartEndE-ValueType
Pfam:F-actin_cap_A 12 278 7.3e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129986
Predicted Effect probably benign
Transcript: ENSMUST00000137148
Predicted Effect probably benign
Transcript: ENSMUST00000149931
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an actin capping protein, one of the F-actin capping protein alpha subunit family. The encoded protein is predominantly localized to the neck region of ejaculated sperm, other immunohistochemical signals were found in the tail and postacrosomal regions. The encoded protein may also form heterodimers of alpha and beta subunits. This protein may be important in determining sperm architecture and male fertility. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for an ENU-induced mutation are infertile, exhibit low epididymal sperm concentrations, and produce sperm with abnormally shaped heads and poor motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,074,794 (GRCm39) C612Y probably benign Het
Adam21 T C 12: 81,606,650 (GRCm39) T371A probably benign Het
Akap9 T C 5: 4,011,279 (GRCm39) S661P Het
Anxa11 C T 14: 25,874,687 (GRCm39) R233C probably damaging Het
Caskin1 C A 17: 24,718,273 (GRCm39) N294K probably damaging Het
Cdh1 T C 8: 107,392,904 (GRCm39) V796A probably benign Het
Cfap251 C T 5: 123,462,438 (GRCm39) P1249L probably damaging Het
Cped1 A T 6: 22,119,578 (GRCm39) T346S possibly damaging Het
Crisp4 A T 1: 18,185,902 (GRCm39) V278D probably damaging Het
Ddx60 A C 8: 62,474,343 (GRCm39) D1477A possibly damaging Het
Dmrtb1 T C 4: 107,537,922 (GRCm39) D82G possibly damaging Het
Dnah11 T C 12: 118,077,647 (GRCm39) N1282S probably benign Het
Dnah11 C T 12: 118,090,550 (GRCm39) V1104M probably benign Het
Dot1l A G 10: 80,621,429 (GRCm39) E630G probably damaging Het
Dppa4 C A 16: 48,108,299 (GRCm39) T28K Het
Dusp5 T A 19: 53,529,745 (GRCm39) S383T probably benign Het
Eef2k C T 7: 120,472,548 (GRCm39) A87V probably damaging Het
Epha1 T C 6: 42,337,961 (GRCm39) Y828C probably damaging Het
Erbb4 A C 1: 68,382,997 (GRCm39) probably null Het
Fam151b T A 13: 92,604,630 (GRCm39) M120L probably benign Het
Fam237b A C 5: 5,625,379 (GRCm39) D25A possibly damaging Het
Fez2 T C 17: 78,689,051 (GRCm39) D366G probably damaging Het
Frmd4b G T 6: 97,272,735 (GRCm39) H886N probably benign Het
Galnt17 T C 5: 130,906,635 (GRCm39) H511R probably benign Het
Grpel1 C A 5: 36,626,816 (GRCm39) Q33K possibly damaging Het
Gzmm A C 10: 79,530,819 (GRCm39) probably null Het
Hmcn1 C A 1: 150,525,723 (GRCm39) L3333F probably damaging Het
Il21r A T 7: 125,231,498 (GRCm39) T309S probably benign Het
Itgal G A 7: 126,929,541 (GRCm39) V1153M probably benign Het
Kdf1 G A 4: 133,257,654 (GRCm39) A390T possibly damaging Het
Lcn11 G T 2: 25,669,296 (GRCm39) R151L probably benign Het
Lgi3 T A 14: 70,770,282 (GRCm39) Y116N probably damaging Het
Llgl2 A G 11: 115,743,866 (GRCm39) H731R probably benign Het
Lrp5 A T 19: 3,641,015 (GRCm39) S1482T probably damaging Het
Meis2 T C 2: 115,889,116 (GRCm39) D212G probably benign Het
Mrgpra9 A G 7: 46,885,242 (GRCm39) C142R possibly damaging Het
Mrgprf A G 7: 144,861,999 (GRCm39) H187R probably benign Het
Mvd A G 8: 123,164,564 (GRCm39) probably null Het
Neb T C 2: 52,096,999 (GRCm39) I4938M possibly damaging Het
Nipal4 A T 11: 46,042,177 (GRCm39) M168K probably benign Het
Nr1h4 A G 10: 89,319,351 (GRCm39) Y158H probably damaging Het
Nrxn2 T C 19: 6,554,920 (GRCm39) I1133T probably benign Het
Numa1 T C 7: 101,650,684 (GRCm39) Y1472H probably benign Het
Or10ak8 A G 4: 118,774,571 (GRCm39) V31A probably benign Het
Or12j3 A G 7: 139,952,698 (GRCm39) V275A probably benign Het
Or2y10 G A 11: 49,455,209 (GRCm39) V154M probably benign Het
Or3a1d T C 11: 74,237,471 (GRCm39) D313G probably benign Het
Or52h7 A G 7: 104,213,619 (GRCm39) M64V possibly damaging Het
Pate7 T A 9: 35,689,384 (GRCm39) probably benign Het
Pcdha6 G T 18: 37,101,484 (GRCm39) V226F probably damaging Het
Pnpla6 G A 8: 3,581,489 (GRCm39) M605I probably benign Het
Ppp1r13l G A 7: 19,105,194 (GRCm39) R322H probably damaging Het
Sgtb T C 13: 104,258,046 (GRCm39) probably null Het
Skint6 T C 4: 112,672,716 (GRCm39) K1086E possibly damaging Het
Slc4a11 T C 2: 130,527,457 (GRCm39) E646G probably damaging Het
Speg G T 1: 75,377,795 (GRCm39) R851L possibly damaging Het
Spns3 T G 11: 72,429,912 (GRCm39) D172A probably damaging Het
Srgap3 A G 6: 112,700,098 (GRCm39) V984A probably benign Het
Syne1 A T 10: 5,223,639 (GRCm39) D3080E probably damaging Het
Taf5l T C 8: 124,730,101 (GRCm39) H196R possibly damaging Het
Tmem229a G C 6: 24,955,587 (GRCm39) R56G probably damaging Het
Tmprss6 A C 15: 78,327,987 (GRCm39) *582G probably null Het
Trip13 C A 13: 74,077,795 (GRCm39) R173L possibly damaging Het
Trpm7 A T 2: 126,661,883 (GRCm39) V1055E probably damaging Het
Utrn A G 10: 12,423,737 (GRCm39) I2T possibly damaging Het
V1rd19 T A 7: 23,703,081 (GRCm39) S182R possibly damaging Het
Vmn2r58 C A 7: 41,486,609 (GRCm39) G762V probably benign Het
Zfp874b T C 13: 67,622,141 (GRCm39) K386E probably damaging Het
Other mutations in Capza3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02138:Capza3 APN 6 139,987,872 (GRCm39) missense probably benign
IGL02228:Capza3 APN 6 139,987,641 (GRCm39) missense probably benign
R1953:Capza3 UTSW 6 139,988,294 (GRCm39) missense possibly damaging 0.59
R4272:Capza3 UTSW 6 139,988,264 (GRCm39) missense probably benign 0.33
R4278:Capza3 UTSW 6 139,987,786 (GRCm39) nonsense probably null
R4421:Capza3 UTSW 6 139,987,768 (GRCm39) missense probably benign
R5504:Capza3 UTSW 6 139,988,165 (GRCm39) missense probably benign 0.42
R7070:Capza3 UTSW 6 139,987,646 (GRCm39) missense probably damaging 1.00
R7661:Capza3 UTSW 6 139,987,498 (GRCm39) missense probably benign 0.07
R9595:Capza3 UTSW 6 139,987,712 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTATCCCATGGACCGTTTTC -3'
(R):5'- ATTCCGTGACTTTGGATATCCC -3'

Sequencing Primer
(F):5'- ATGGACCGTTTTCTCACCCTGTG -3'
(R):5'- CAGTTGATTCTGGAGTAGGTCAAACC -3'
Posted On 2021-07-15