Incidental Mutation 'R8881:Ddx60'
ID 676923
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R8881 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 62021309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1477 (D1477A)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000070631
AA Change: D1476A

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: D1476A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: D1477A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: D1477A

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Meta Mutation Damage Score 0.2001 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G A 7: 120,475,571 C612Y probably benign Het
Adam21 T C 12: 81,559,876 T371A probably benign Het
Akap9 T C 5: 3,961,279 S661P Het
Anxa11 C T 14: 25,874,263 R233C probably damaging Het
Capza3 A C 6: 140,041,795 D40A probably damaging Het
Caskin1 C A 17: 24,499,299 N294K probably damaging Het
Cdh1 T C 8: 106,666,272 V796A probably benign Het
Cped1 A T 6: 22,119,579 T346S possibly damaging Het
Crisp4 A T 1: 18,115,678 V278D probably damaging Het
Dmrtb1 T C 4: 107,680,725 D82G possibly damaging Het
Dnah11 T C 12: 118,113,912 N1282S probably benign Het
Dnah11 C T 12: 118,126,815 V1104M probably benign Het
Dot1l A G 10: 80,785,595 E630G probably damaging Het
Dppa4 C A 16: 48,287,936 T28K Het
Dusp5 T A 19: 53,541,314 S383T probably benign Het
Eef2k C T 7: 120,873,325 A87V probably damaging Het
Epha1 T C 6: 42,361,027 Y828C probably damaging Het
Erbb4 A C 1: 68,343,838 probably null Het
Fam151b T A 13: 92,468,122 M120L probably benign Het
Fez2 T C 17: 78,381,622 D366G probably damaging Het
Frmd4b G T 6: 97,295,774 H886N probably benign Het
Galnt17 T C 5: 130,877,797 H511R probably benign Het
Gm17727 T A 9: 35,778,088 probably benign Het
Gm8773 A C 5: 5,575,379 D25A possibly damaging Het
Grpel1 C A 5: 36,469,472 Q33K possibly damaging Het
Gzmm A C 10: 79,694,985 probably null Het
Hmcn1 C A 1: 150,649,972 L3333F probably damaging Het
Il21r A T 7: 125,632,326 T309S probably benign Het
Itgal G A 7: 127,330,369 V1153M probably benign Het
Kdf1 G A 4: 133,530,343 A390T possibly damaging Het
Lcn11 G T 2: 25,779,284 R151L probably benign Het
Lgi3 T A 14: 70,532,842 Y116N probably damaging Het
Llgl2 A G 11: 115,853,040 H731R probably benign Het
Lrp5 A T 19: 3,591,015 S1482T probably damaging Het
Meis2 T C 2: 116,058,635 D212G probably benign Het
Mrgpra9 A G 7: 47,235,494 C142R possibly damaging Het
Mrgprf A G 7: 145,308,262 H187R probably benign Het
Mvd A G 8: 122,437,825 probably null Het
Neb T C 2: 52,206,987 I4938M possibly damaging Het
Nipal4 A T 11: 46,151,350 M168K probably benign Het
Nr1h4 A G 10: 89,483,489 Y158H probably damaging Het
Nrxn2 T C 19: 6,504,890 I1133T probably benign Het
Numa1 T C 7: 102,001,477 Y1472H probably benign Het
Olfr1329 A G 4: 118,917,374 V31A probably benign Het
Olfr1380 G A 11: 49,564,382 V154M probably benign Het
Olfr411 T C 11: 74,346,645 D313G probably benign Het
Olfr530 A G 7: 140,372,785 V275A probably benign Het
Olfr652 A G 7: 104,564,412 M64V possibly damaging Het
Pcdha6 G T 18: 36,968,431 V226F probably damaging Het
Pnpla6 G A 8: 3,531,489 M605I probably benign Het
Ppp1r13l G A 7: 19,371,269 R322H probably damaging Het
Sgtb T C 13: 104,121,538 probably null Het
Skint6 T C 4: 112,815,519 K1086E possibly damaging Het
Slc4a11 T C 2: 130,685,537 E646G probably damaging Het
Speg G T 1: 75,401,151 R851L possibly damaging Het
Spns3 T G 11: 72,539,086 D172A probably damaging Het
Srgap3 A G 6: 112,723,137 V984A probably benign Het
Syne1 A T 10: 5,273,639 D3080E probably damaging Het
Taf5l T C 8: 124,003,362 H196R possibly damaging Het
Tmem229a G C 6: 24,955,588 R56G probably damaging Het
Tmprss6 A C 15: 78,443,787 *582G probably null Het
Trip13 C A 13: 73,929,676 R173L possibly damaging Het
Trpm7 A T 2: 126,819,963 V1055E probably damaging Het
Utrn A G 10: 12,547,993 I2T possibly damaging Het
V1rd19 T A 7: 24,003,656 S182R possibly damaging Het
Vmn2r58 C A 7: 41,837,185 G762V probably benign Het
Wdr66 C T 5: 123,324,375 P1249L probably damaging Het
Zfp874b T C 13: 67,474,022 K386E probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
Scatter UTSW 8 62021314 missense possibly damaging 0.80
shotgun UTSW 8 62037067 missense probably benign 0.28
splay UTSW 8 62021309 missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62000597 missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
R8826:Ddx60 UTSW 8 61945956 missense probably benign 0.02
R8829:Ddx60 UTSW 8 61940661 missense probably damaging 1.00
R8884:Ddx60 UTSW 8 61994519 missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61974134 nonsense probably null
R9122:Ddx60 UTSW 8 61989864 missense probably benign 0.16
R9225:Ddx60 UTSW 8 62017841 missense probably benign 0.36
R9278:Ddx60 UTSW 8 61977978 missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62009960 missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61972214 missense probably benign 0.03
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TGAGCATGGAGTAATTTGAAGC -3'
(R):5'- CGTGAAATCCAATTGCTTTTGACAC -3'

Sequencing Primer
(F):5'- CATGGAGTAATTTGAAGCTGGGAAG -3'
(R):5'- GACACATTTCTGACAGACTCTGTG -3'
Posted On 2021-07-15