Incidental Mutation 'R8882:Olfr291'
ID 676980
Institutional Source Beutler Lab
Gene Symbol Olfr291
Ensembl Gene ENSMUSG00000070460
Gene Name olfactory receptor 291
Synonyms GA_x6K02T2NHDJ-11231385-11230438, MOR254-2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.049) question?
Stock # R8882 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84853553-84859612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84856473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 37 (Y37H)
Ref Sequence ENSEMBL: ENSMUSP00000148266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000211582] [ENSMUST00000217039]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000211582
AA Change: Y37H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217039
AA Change: Y35H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 A T 13: 111,255,499 I123L probably benign Het
Adam18 T C 8: 24,646,422 D361G probably benign Het
Adcyap1r1 G A 6: 55,491,234 V352M possibly damaging Het
Ahnak T C 19: 9,000,742 L75P probably damaging Het
Arhgap23 T C 11: 97,465,123 S856P probably benign Het
Asprv1 G T 6: 86,628,367 C65F probably benign Het
Atp2b4 A T 1: 133,726,455 probably null Het
Cd55 A G 1: 130,459,764 V99A probably benign Het
Cit G A 5: 115,863,030 A163T probably benign Het
Dnah6 A T 6: 73,178,498 D711E probably benign Het
Dnajc15 A T 14: 77,856,971 V41E probably damaging Het
Dock2 GCACACACACA GCACACACACACA 11: 34,704,609 453 probably null Het
Dst T C 1: 34,200,924 S1785P probably damaging Het
Efhb A G 17: 53,462,684 V199A probably damaging Het
Esyt3 C T 9: 99,320,856 G498D probably damaging Het
Fbxo11 A G 17: 87,997,529 I562T Het
Fh1 C T 1: 175,609,787 V249I possibly damaging Het
Gdpgp1 T C 7: 80,238,956 I245T possibly damaging Het
Hinfp A G 9: 44,298,332 probably null Het
Hip1r A G 5: 124,001,962 K1043E probably damaging Het
Htt G A 5: 34,821,717 V815I probably benign Het
Jrk A G 15: 74,707,155 Y94H probably damaging Het
Krit1 T A 5: 3,836,864 N704K possibly damaging Het
Mmp17 A G 5: 129,601,944 D331G probably benign Het
Nlrp9a T A 7: 26,558,278 Y440* probably null Het
Nphp3 A G 9: 104,005,594 T216A possibly damaging Het
Olfr1252 G T 2: 89,721,396 C238* probably null Het
Olfr397 T G 11: 73,965,114 C169G probably damaging Het
Olfr872 T C 9: 20,259,960 F40S probably benign Het
Olfr893 T A 9: 38,209,165 Y35* probably null Het
Parva T C 7: 112,428,004 S14P probably benign Het
Pax6 A C 2: 105,691,618 N207H possibly damaging Het
Pde6a A G 18: 61,245,548 N314S Het
Phlpp1 T A 1: 106,392,642 S1456T probably benign Het
Plxnc1 A G 10: 94,841,566 V933A probably damaging Het
Rasgef1b A G 5: 99,377,001 S100P probably benign Het
Rpn2 A G 2: 157,294,182 H170R probably benign Het
Sbds A G 5: 130,253,937 probably null Het
Scube2 G C 7: 109,852,473 L158V probably damaging Het
Slc16a12 C A 19: 34,672,454 V394L probably benign Het
Slc23a2 A T 2: 132,091,239 Y100N possibly damaging Het
Slc30a9 G T 5: 67,315,701 E43* probably null Het
Specc1l A T 10: 75,229,855 M1L unknown Het
Sspo T A 6: 48,475,456 C2785S probably damaging Het
Star T C 8: 25,812,869 S280P probably benign Het
Strip1 A T 3: 107,627,025 M127K probably benign Het
Tbx19 C T 1: 165,139,211 V365M probably benign Het
Tex2 T C 11: 106,544,236 D788G unknown Het
Tspyl1 A G 10: 34,282,498 E73G possibly damaging Het
Ulk2 C T 11: 61,808,061 probably null Het
Vmn2r120 A T 17: 57,545,229 M29K probably benign Het
Vmn2r60 C A 7: 42,141,094 Q502K probably benign Het
Xpo5 A G 17: 46,227,740 D624G possibly damaging Het
Zfp119b T C 17: 55,939,923 R88G possibly damaging Het
Zfp879 C A 11: 50,833,936 E98* probably null Het
Other mutations in Olfr291
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Olfr291 APN 7 84856411 missense probably damaging 1.00
IGL02643:Olfr291 APN 7 84857031 missense probably damaging 1.00
IGL02928:Olfr291 APN 7 84857065 missense probably benign 0.08
IGL03124:Olfr291 APN 7 84856723 missense probably damaging 0.99
R0129:Olfr291 UTSW 7 84856988 missense probably benign
R0605:Olfr291 UTSW 7 84857137 missense probably damaging 1.00
R1085:Olfr291 UTSW 7 84856779 missense probably benign 0.05
R1477:Olfr291 UTSW 7 84857017 missense probably damaging 1.00
R1834:Olfr291 UTSW 7 84856482 missense probably damaging 0.99
R1839:Olfr291 UTSW 7 84856548 missense probably damaging 1.00
R2036:Olfr291 UTSW 7 84856358 start gained probably benign
R4214:Olfr291 UTSW 7 84857289 missense probably benign
R4386:Olfr291 UTSW 7 84856548 missense probably damaging 1.00
R4679:Olfr291 UTSW 7 84856904 nonsense probably null
R4789:Olfr291 UTSW 7 84857301 missense probably benign 0.09
R4841:Olfr291 UTSW 7 84857120 missense probably damaging 1.00
R5011:Olfr291 UTSW 7 84856438 missense probably damaging 1.00
R5013:Olfr291 UTSW 7 84856438 missense probably damaging 1.00
R6127:Olfr291 UTSW 7 84857202 missense probably damaging 1.00
R7164:Olfr291 UTSW 7 84857043 missense possibly damaging 0.73
R7328:Olfr291 UTSW 7 84857299 missense probably benign 0.01
R8347:Olfr291 UTSW 7 84856755 missense probably damaging 0.99
R8434:Olfr291 UTSW 7 84857289 missense probably benign
R9242:Olfr291 UTSW 7 84856878 nonsense probably null
R9640:Olfr291 UTSW 7 84856906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTAGTTTCTCACAAGCAGG -3'
(R):5'- GCCACCAGGAAATAGAGCTG -3'

Sequencing Primer
(F):5'- TAGTTTCTCACAAGCAGGATCCC -3'
(R):5'- ACAAAGGAAATGCTGTGATCCTC -3'
Posted On 2021-07-15