Incidental Mutation 'R8882:Scube2'
ID 676981
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock # R8882 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 109852473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 158 (L158V)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: L158V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: L158V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: L158V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: L158V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: L158V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: L158V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 A T 13: 111,255,499 I123L probably benign Het
Adam18 T C 8: 24,646,422 D361G probably benign Het
Adcyap1r1 G A 6: 55,491,234 V352M possibly damaging Het
Ahnak T C 19: 9,000,742 L75P probably damaging Het
Arhgap23 T C 11: 97,465,123 S856P probably benign Het
Asprv1 G T 6: 86,628,367 C65F probably benign Het
Atp2b4 A T 1: 133,726,455 probably null Het
Cd55 A G 1: 130,459,764 V99A probably benign Het
Cit G A 5: 115,863,030 A163T probably benign Het
Dnah6 A T 6: 73,178,498 D711E probably benign Het
Dnajc15 A T 14: 77,856,971 V41E probably damaging Het
Dock2 GCACACACACA GCACACACACACA 11: 34,704,609 453 probably null Het
Dst T C 1: 34,200,924 S1785P probably damaging Het
Efhb A G 17: 53,462,684 V199A probably damaging Het
Esyt3 C T 9: 99,320,856 G498D probably damaging Het
Fbxo11 A G 17: 87,997,529 I562T Het
Fh1 C T 1: 175,609,787 V249I possibly damaging Het
Gdpgp1 T C 7: 80,238,956 I245T possibly damaging Het
Hinfp A G 9: 44,298,332 probably null Het
Hip1r A G 5: 124,001,962 K1043E probably damaging Het
Htt G A 5: 34,821,717 V815I probably benign Het
Jrk A G 15: 74,707,155 Y94H probably damaging Het
Krit1 T A 5: 3,836,864 N704K possibly damaging Het
Mmp17 A G 5: 129,601,944 D331G probably benign Het
Nlrp9a T A 7: 26,558,278 Y440* probably null Het
Nphp3 A G 9: 104,005,594 T216A possibly damaging Het
Olfr1252 G T 2: 89,721,396 C238* probably null Het
Olfr291 T C 7: 84,856,473 Y37H probably damaging Het
Olfr397 T G 11: 73,965,114 C169G probably damaging Het
Olfr872 T C 9: 20,259,960 F40S probably benign Het
Olfr893 T A 9: 38,209,165 Y35* probably null Het
Parva T C 7: 112,428,004 S14P probably benign Het
Pax6 A C 2: 105,691,618 N207H possibly damaging Het
Pde6a A G 18: 61,245,548 N314S Het
Phlpp1 T A 1: 106,392,642 S1456T probably benign Het
Plxnc1 A G 10: 94,841,566 V933A probably damaging Het
Rasgef1b A G 5: 99,377,001 S100P probably benign Het
Rpn2 A G 2: 157,294,182 H170R probably benign Het
Sbds A G 5: 130,253,937 probably null Het
Slc16a12 C A 19: 34,672,454 V394L probably benign Het
Slc23a2 A T 2: 132,091,239 Y100N possibly damaging Het
Slc30a9 G T 5: 67,315,701 E43* probably null Het
Specc1l A T 10: 75,229,855 M1L unknown Het
Sspo T A 6: 48,475,456 C2785S probably damaging Het
Star T C 8: 25,812,869 S280P probably benign Het
Strip1 A T 3: 107,627,025 M127K probably benign Het
Tbx19 C T 1: 165,139,211 V365M probably benign Het
Tex2 T C 11: 106,544,236 D788G unknown Het
Tspyl1 A G 10: 34,282,498 E73G possibly damaging Het
Ulk2 C T 11: 61,808,061 probably null Het
Vmn2r120 A T 17: 57,545,229 M29K probably benign Het
Vmn2r60 C A 7: 42,141,094 Q502K probably benign Het
Xpo5 A G 17: 46,227,740 D624G possibly damaging Het
Zfp119b T C 17: 55,939,923 R88G possibly damaging Het
Zfp879 C A 11: 50,833,936 E98* probably null Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9709:Scube2 UTSW 7 109831764 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGACACTCTGCTTCCAGG -3'
(R):5'- AAGAGGAACCTTGTCTCCGC -3'

Sequencing Primer
(F):5'- ACTCTGCTTCCAGGATAAAGTC -3'
(R):5'- CTTGTCTCCGCTTAGCAGGAG -3'
Posted On 2021-07-15