Incidental Mutation 'R8882:Nphp3'
ID 676989
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8882 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104005594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 216 (T216A)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
AlphaFold Q7TNH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000035167
AA Change: T216A

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: T216A

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193439
AA Change: T122A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: T122A

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: T96A

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 A T 13: 111,255,499 I123L probably benign Het
Adam18 T C 8: 24,646,422 D361G probably benign Het
Adcyap1r1 G A 6: 55,491,234 V352M possibly damaging Het
Ahnak T C 19: 9,000,742 L75P probably damaging Het
Arhgap23 T C 11: 97,465,123 S856P probably benign Het
Asprv1 G T 6: 86,628,367 C65F probably benign Het
Atp2b4 A T 1: 133,726,455 probably null Het
Cd55 A G 1: 130,459,764 V99A probably benign Het
Cit G A 5: 115,863,030 A163T probably benign Het
Dnah6 A T 6: 73,178,498 D711E probably benign Het
Dnajc15 A T 14: 77,856,971 V41E probably damaging Het
Dock2 GCACACACACA GCACACACACACA 11: 34,704,609 453 probably null Het
Dst T C 1: 34,200,924 S1785P probably damaging Het
Efhb A G 17: 53,462,684 V199A probably damaging Het
Esyt3 C T 9: 99,320,856 G498D probably damaging Het
Fbxo11 A G 17: 87,997,529 I562T Het
Fh1 C T 1: 175,609,787 V249I possibly damaging Het
Gdpgp1 T C 7: 80,238,956 I245T possibly damaging Het
Hinfp A G 9: 44,298,332 probably null Het
Hip1r A G 5: 124,001,962 K1043E probably damaging Het
Htt G A 5: 34,821,717 V815I probably benign Het
Jrk A G 15: 74,707,155 Y94H probably damaging Het
Krit1 T A 5: 3,836,864 N704K possibly damaging Het
Mmp17 A G 5: 129,601,944 D331G probably benign Het
Nlrp9a T A 7: 26,558,278 Y440* probably null Het
Olfr1252 G T 2: 89,721,396 C238* probably null Het
Olfr291 T C 7: 84,856,473 Y37H probably damaging Het
Olfr397 T G 11: 73,965,114 C169G probably damaging Het
Olfr872 T C 9: 20,259,960 F40S probably benign Het
Olfr893 T A 9: 38,209,165 Y35* probably null Het
Parva T C 7: 112,428,004 S14P probably benign Het
Pax6 A C 2: 105,691,618 N207H possibly damaging Het
Pde6a A G 18: 61,245,548 N314S Het
Phlpp1 T A 1: 106,392,642 S1456T probably benign Het
Plxnc1 A G 10: 94,841,566 V933A probably damaging Het
Rasgef1b A G 5: 99,377,001 S100P probably benign Het
Rpn2 A G 2: 157,294,182 H170R probably benign Het
Sbds A G 5: 130,253,937 probably null Het
Scube2 G C 7: 109,852,473 L158V probably damaging Het
Slc16a12 C A 19: 34,672,454 V394L probably benign Het
Slc23a2 A T 2: 132,091,239 Y100N possibly damaging Het
Slc30a9 G T 5: 67,315,701 E43* probably null Het
Specc1l A T 10: 75,229,855 M1L unknown Het
Sspo T A 6: 48,475,456 C2785S probably damaging Het
Star T C 8: 25,812,869 S280P probably benign Het
Strip1 A T 3: 107,627,025 M127K probably benign Het
Tbx19 C T 1: 165,139,211 V365M probably benign Het
Tex2 T C 11: 106,544,236 D788G unknown Het
Tspyl1 A G 10: 34,282,498 E73G possibly damaging Het
Ulk2 C T 11: 61,808,061 probably null Het
Vmn2r120 A T 17: 57,545,229 M29K probably benign Het
Vmn2r60 C A 7: 42,141,094 Q502K probably benign Het
Xpo5 A G 17: 46,227,740 D624G possibly damaging Het
Zfp119b T C 17: 55,939,923 R88G possibly damaging Het
Zfp879 C A 11: 50,833,936 E98* probably null Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9226:Nphp3 UTSW 9 104008129 missense probably benign 0.00
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAACTTGGTGGCACAATTCTG -3'
(R):5'- GCTCCTGACATCATACACTTAGAGG -3'

Sequencing Primer
(F):5'- TTCAGGACTTACTGAGGGC -3'
(R):5'- CACTTAGAGGAGATGATGTCCTGAC -3'
Posted On 2021-07-15