Incidental Mutation 'R8882:Efhb'
ID677003
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R8882 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53462684 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 199 (V199A)
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect probably damaging
Transcript: ENSMUST00000024725
AA Change: V199A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931
AA Change: V199A

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 A T 13: 111,255,499 I123L probably benign Het
Adam18 T C 8: 24,646,422 D361G probably benign Het
Adcyap1r1 G A 6: 55,491,234 V352M possibly damaging Het
Ahnak T C 19: 9,000,742 L75P probably damaging Het
Arhgap23 T C 11: 97,465,123 S856P probably benign Het
Asprv1 G T 6: 86,628,367 C65F probably benign Het
Atp2b4 A T 1: 133,726,455 probably null Het
Cd55 A G 1: 130,459,764 V99A probably benign Het
Cit G A 5: 115,863,030 A163T probably benign Het
Dnah6 A T 6: 73,178,498 D711E probably benign Het
Dnajc15 A T 14: 77,856,971 V41E probably damaging Het
Dock2 GCACACACACA GCACACACACACA 11: 34,704,609 probably null Het
Dst T C 1: 34,200,924 S1785P probably damaging Het
Esyt3 C T 9: 99,320,856 G498D probably damaging Het
Fbxo11 A G 17: 87,997,529 I562T Het
Fh1 C T 1: 175,609,787 V249I possibly damaging Het
Gdpgp1 T C 7: 80,238,956 I245T possibly damaging Het
Hinfp A G 9: 44,298,332 probably null Het
Hip1r A G 5: 124,001,962 K1043E probably damaging Het
Htt G A 5: 34,821,717 V815I probably benign Het
Jrk A G 15: 74,707,155 Y94H probably damaging Het
Krit1 T A 5: 3,836,864 N704K possibly damaging Het
Mmp17 A G 5: 129,601,944 D331G probably benign Het
Nlrp9a T A 7: 26,558,278 Y440* probably null Het
Nphp3 A G 9: 104,005,594 T216A possibly damaging Het
Olfr1252 G T 2: 89,721,396 C238* probably null Het
Olfr291 T C 7: 84,856,473 Y37H probably damaging Het
Olfr397 T G 11: 73,965,114 C169G probably damaging Het
Olfr872 T C 9: 20,259,960 F40S probably benign Het
Olfr893 T A 9: 38,209,165 Y35* probably null Het
Parva T C 7: 112,428,004 S14P probably benign Het
Pax6 A C 2: 105,691,618 N207H possibly damaging Het
Pde6a A G 18: 61,245,548 N314S Het
Phlpp1 T A 1: 106,392,642 S1456T probably benign Het
Plxnc1 A G 10: 94,841,566 V933A probably damaging Het
Rasgef1b A G 5: 99,377,001 S100P probably benign Het
Rpn2 A G 2: 157,294,182 H170R probably benign Het
Sbds A G 5: 130,253,937 probably null Het
Scube2 G C 7: 109,852,473 L158V probably damaging Het
Slc16a12 C A 19: 34,672,454 V394L probably benign Het
Slc23a2 A T 2: 132,091,239 Y100N possibly damaging Het
Slc30a9 G T 5: 67,315,701 E43* probably null Het
Specc1l A T 10: 75,229,855 M1L unknown Het
Sspo T A 6: 48,475,456 C2785S probably damaging Het
Star T C 8: 25,812,869 S280P probably benign Het
Strip1 A T 3: 107,627,025 M127K probably benign Het
Tbx19 C T 1: 165,139,211 V365M probably benign Het
Tex2 T C 11: 106,544,236 D788G unknown Het
Tspyl1 A G 10: 34,282,498 E73G possibly damaging Het
Ulk2 C T 11: 61,808,061 probably null Het
Vmn2r120 A T 17: 57,545,229 M29K probably benign Het
Vmn2r60 C A 7: 42,141,094 Q502K probably benign Het
Xpo5 A G 17: 46,227,740 D624G possibly damaging Het
Zfp119b T C 17: 55,939,923 R88G possibly damaging Het
Zfp879 C A 11: 50,833,936 E98* probably null Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2085:Efhb UTSW 17 53426909 critical splice donor site probably null
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R2415:Efhb UTSW 17 53463096 missense probably benign 0.01
R3848:Efhb UTSW 17 53426996 splice site probably benign
R3858:Efhb UTSW 17 53462780 missense possibly damaging 0.61
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8044:Efhb UTSW 17 53399115 missense probably benign 0.41
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATATGGGCCTGATGTTCCCTGG -3'
(R):5'- AGAAAACAAGGGCCTTCCGC -3'

Sequencing Primer
(F):5'- CTGATGTTCCCTGGAGGCTC -3'
(R):5'- TCGCCTTCGCTACGGAG -3'
Posted On2021-07-15