Incidental Mutation 'R8882:Vmn2r120'
ID677005
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R8882 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57545229 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 29 (M29K)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect probably benign
Transcript: ENSMUST00000165781
AA Change: M29K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: M29K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actbl2 A T 13: 111,255,499 I123L probably benign Het
Adam18 T C 8: 24,646,422 D361G probably benign Het
Adcyap1r1 G A 6: 55,491,234 V352M possibly damaging Het
Ahnak T C 19: 9,000,742 L75P probably damaging Het
Arhgap23 T C 11: 97,465,123 S856P probably benign Het
Asprv1 G T 6: 86,628,367 C65F probably benign Het
Atp2b4 A T 1: 133,726,455 probably null Het
Cd55 A G 1: 130,459,764 V99A probably benign Het
Cit G A 5: 115,863,030 A163T probably benign Het
Dnah6 A T 6: 73,178,498 D711E probably benign Het
Dnajc15 A T 14: 77,856,971 V41E probably damaging Het
Dock2 GCACACACACA GCACACACACACA 11: 34,704,609 probably null Het
Dst T C 1: 34,200,924 S1785P probably damaging Het
Efhb A G 17: 53,462,684 V199A probably damaging Het
Esyt3 C T 9: 99,320,856 G498D probably damaging Het
Fbxo11 A G 17: 87,997,529 I562T Het
Fh1 C T 1: 175,609,787 V249I possibly damaging Het
Gdpgp1 T C 7: 80,238,956 I245T possibly damaging Het
Hinfp A G 9: 44,298,332 probably null Het
Hip1r A G 5: 124,001,962 K1043E probably damaging Het
Htt G A 5: 34,821,717 V815I probably benign Het
Jrk A G 15: 74,707,155 Y94H probably damaging Het
Krit1 T A 5: 3,836,864 N704K possibly damaging Het
Mmp17 A G 5: 129,601,944 D331G probably benign Het
Nlrp9a T A 7: 26,558,278 Y440* probably null Het
Nphp3 A G 9: 104,005,594 T216A possibly damaging Het
Olfr1252 G T 2: 89,721,396 C238* probably null Het
Olfr291 T C 7: 84,856,473 Y37H probably damaging Het
Olfr397 T G 11: 73,965,114 C169G probably damaging Het
Olfr872 T C 9: 20,259,960 F40S probably benign Het
Olfr893 T A 9: 38,209,165 Y35* probably null Het
Parva T C 7: 112,428,004 S14P probably benign Het
Pax6 A C 2: 105,691,618 N207H possibly damaging Het
Pde6a A G 18: 61,245,548 N314S Het
Phlpp1 T A 1: 106,392,642 S1456T probably benign Het
Plxnc1 A G 10: 94,841,566 V933A probably damaging Het
Rasgef1b A G 5: 99,377,001 S100P probably benign Het
Rpn2 A G 2: 157,294,182 H170R probably benign Het
Sbds A G 5: 130,253,937 probably null Het
Scube2 G C 7: 109,852,473 L158V probably damaging Het
Slc16a12 C A 19: 34,672,454 V394L probably benign Het
Slc23a2 A T 2: 132,091,239 Y100N possibly damaging Het
Slc30a9 G T 5: 67,315,701 E43* probably null Het
Specc1l A T 10: 75,229,855 M1L unknown Het
Sspo T A 6: 48,475,456 C2785S probably damaging Het
Star T C 8: 25,812,869 S280P probably benign Het
Strip1 A T 3: 107,627,025 M127K probably benign Het
Tbx19 C T 1: 165,139,211 V365M probably benign Het
Tex2 T C 11: 106,544,236 D788G unknown Het
Tspyl1 A G 10: 34,282,498 E73G possibly damaging Het
Ulk2 C T 11: 61,808,061 probably null Het
Vmn2r60 C A 7: 42,141,094 Q502K probably benign Het
Xpo5 A G 17: 46,227,740 D624G possibly damaging Het
Zfp119b T C 17: 55,939,923 R88G possibly damaging Het
Zfp879 C A 11: 50,833,936 E98* probably null Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1922:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
R7653:Vmn2r120 UTSW 17 57509258 missense possibly damaging 0.93
R7667:Vmn2r120 UTSW 17 57536657 missense probably benign 0.04
R7775:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7778:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7797:Vmn2r120 UTSW 17 57508874 missense probably damaging 1.00
R7824:Vmn2r120 UTSW 17 57525942 missense probably damaging 1.00
R7902:Vmn2r120 UTSW 17 57509244 missense possibly damaging 0.87
R7922:Vmn2r120 UTSW 17 57524683 missense probably damaging 0.99
R8508:Vmn2r120 UTSW 17 57525843 missense probably benign 0.03
R8847:Vmn2r120 UTSW 17 57509217 missense probably benign 0.01
RF005:Vmn2r120 UTSW 17 57521991 missense possibly damaging 0.65
Z1177:Vmn2r120 UTSW 17 57509245 missense probably benign 0.00
Z1188:Vmn2r120 UTSW 17 57522436 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACAGCTGTACATACTTTCTGTG -3'
(R):5'- TGAGTAGACTCTCCAGCCTACAAC -3'

Sequencing Primer
(F):5'- GTGTATTATCCACCATGACATTCAG -3'
(R):5'- ACATATAAGTGCCCATATACATGAAC -3'
Posted On2021-07-15