Incidental Mutation 'R8731:Cdk5rap2'
ID 677012
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 068579-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R8731 (G1)
Quality Score 212.009
Status Validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 70163747 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140108
Predicted Effect probably benign
Transcript: ENSMUST00000144099
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 95.9%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A T 3: 59,932,367 (GRCm39) D294V probably benign Het
Abcc8 T G 7: 45,803,986 (GRCm39) Y396S probably damaging Het
Ace T A 11: 105,861,426 (GRCm39) F192I possibly damaging Het
Apeh A G 9: 107,964,422 (GRCm39) S494P probably benign Het
Bod1 A G 11: 31,619,242 (GRCm39) probably null Het
Cap2 T C 13: 46,800,006 (GRCm39) M404T probably benign Het
Cc2d2a A T 5: 43,892,788 (GRCm39) D1450V probably damaging Het
Clip1 A C 5: 123,752,756 (GRCm39) S342A Het
Cox10 A G 11: 63,855,045 (GRCm39) F412S probably damaging Het
Cracr2a T G 6: 127,602,890 (GRCm39) probably null Het
Dcaf7 T A 11: 105,945,548 (GRCm39) M299K possibly damaging Het
Dffb T C 4: 154,059,101 (GRCm39) T59A possibly damaging Het
Dgkd A G 1: 87,844,535 (GRCm39) M234V possibly damaging Het
Disp1 A T 1: 182,869,072 (GRCm39) V1116E possibly damaging Het
Dpysl3 C T 18: 43,571,157 (GRCm39) C39Y probably damaging Het
Dync1h1 T A 12: 110,607,018 (GRCm39) V2565D possibly damaging Het
Fam227b A T 2: 125,968,898 (GRCm39) Y59N possibly damaging Het
Gm21680 A T 5: 26,173,230 (GRCm39) V210D probably damaging Het
Gm57858 A T 3: 36,089,434 (GRCm39) N163K probably benign Het
Gnas T C 2: 174,126,699 (GRCm39) V78A probably benign Het
Gpr179 T C 11: 97,234,555 (GRCm39) T509A probably damaging Het
Igfn1 A G 1: 135,925,574 (GRCm39) M60T probably benign Het
Llgl2 A G 11: 115,742,016 (GRCm39) Q686R probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Mylk3 T G 8: 86,085,634 (GRCm39) E300A probably benign Het
Myo1b A C 1: 51,799,570 (GRCm39) probably benign Het
Myo9b T C 8: 71,806,486 (GRCm39) probably null Het
Nalcn T C 14: 123,837,266 (GRCm39) I33V probably benign Het
Nsl1 A G 1: 190,814,609 (GRCm39) Y270C probably damaging Het
Or5af1 C T 11: 58,722,268 (GRCm39) A96V probably benign Het
Otulin A G 15: 27,608,928 (GRCm39) M205T probably benign Het
Plch1 A T 3: 63,605,059 (GRCm39) V1615E probably benign Het
Rab9 C T X: 165,240,754 (GRCm39) D186N probably benign Het
Repin1 G T 6: 48,574,279 (GRCm39) E403* probably null Het
Scn3a A T 2: 65,298,507 (GRCm39) Y1397* probably null Het
Scrib A T 15: 75,935,488 (GRCm39) H549Q probably benign Het
Slc36a4 A G 9: 15,631,048 (GRCm39) I56V possibly damaging Het
Spata7 T A 12: 98,624,541 (GRCm39) S148T probably damaging Het
Stk31 T A 6: 49,415,435 (GRCm39) L590Q probably benign Het
Tanc1 T C 2: 59,673,596 (GRCm39) V1567A probably benign Het
Tspan33 T C 6: 29,717,310 (GRCm39) F237S probably damaging Het
Uhrf1 T A 17: 56,629,363 (GRCm39) L737Q probably damaging Het
Vmn2r2 A G 3: 64,024,404 (GRCm39) F726L probably benign Het
Vmn2r65 A T 7: 84,589,447 (GRCm39) L823* probably null Het
Vps11 T C 9: 44,265,756 (GRCm39) N508D probably benign Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70,153,691 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGTGGCGATTCTTGGAAAC -3'
(R):5'- TCAGTTGAAGTATGGAAGCCTC -3'

Sequencing Primer
(F):5'- CAAGGATTTTGTGGCTCAGGG -3'
(R):5'- AAGTATGGAAGCCTCTTTTTGCC -3'
Posted On 2021-07-28