Mutagenetix > Incidental Mutations

Incidental Mutation 'G1Funyon:Cfap57'

677057

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

G1Funyon (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118593074 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 617 (I617T)

Ref Sequence

ENSEMBL: ENSMUSP00000071863 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071972
AA Change: I617T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: I617T

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081921
AA Change: I617T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: I617T

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	A	T	5: 87,972,505	I374F	probably benign	Het
Aldh16a1	C	T	7: 45,141,982	A790T	possibly damaging	Het
Anks1	A	T	17: 28,059,580		probably benign	Het
Antxr2	T	G	5: 97,977,679	T240P	probably benign	Het
Arfgef1	A	T	1: 10,179,833	M945K	probably damaging	Het
Arhgef17	T	C	7: 100,879,659	T1591A	probably benign	Het
Aurka	A	G	2: 172,356,930	S374P	probably damaging	Het
Bccip	T	C	7: 133,719,204	S236P	probably benign	Het
Cacna1s	T	A	1: 136,073,441		probably benign	Het
Calm1	A	G	12: 100,205,685	E132G	probably benign	Het
Casz1	A	G	4: 148,946,043	D1173G	probably damaging	Het
Cdh17	A	G	4: 11,795,659	D413G	probably damaging	Het
Csnka2ip	A	C	16: 64,478,991	S337A	unknown	Het
Ddx60	A	G	8: 62,000,597	E1250G	probably benign	Het
Dlgap2	T	A	8: 14,823,577	S727T	probably benign	Het
Dpy19l1	T	C	9: 24,485,111		probably benign	Het
Ebf2	A	G	14: 67,238,982	T134A	possibly damaging	Het
Echdc2	A	T	4: 108,172,909	M136L	probably benign	Het
Enpp2	A	G	15: 54,851,407	F598S	probably benign	Het
Extl3	A	C	14: 65,076,284	L483R	probably damaging	Het
Gcat	T	C	15: 79,035,889	V227A	possibly damaging	Het
Hsf2	A	G	10: 57,505,346	D344G	probably damaging	Het
Ighm	C	T	12: 113,421,545	G265D		Het
Igsf9b	T	G	9: 27,334,739		probably benign	Het
Ints6	A	G	14: 62,702,453	V596A	probably benign	Het
Ints8	T	C	4: 11,246,120	E182G	probably damaging	Het
Iqgap2	A	G	13: 95,682,151		probably null	Het
Kalrn	G	T	16: 34,357,100	Q250K	probably benign	Het
Lrrc1	T	A	9: 77,544,488	N46Y	probably damaging	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naa50	A	G	16: 44,157,131	N74S	probably benign	Het
Neb	T	C	2: 52,288,835	N1303S	probably benign	Het
Nfs1	A	T	2: 156,134,493	C160*	probably null	Het
Olfr472	A	G	7: 107,903,626	K303R	probably benign	Het
Olfr591	T	G	7: 103,173,073	K188T	probably damaging	Het
Olfr740	T	A	14: 50,453,564	S171T	probably benign	Het
Olfr809	T	C	10: 129,776,840	S309P	probably benign	Het
Orm2	T	C	4: 63,363,026	F67S	possibly damaging	Het
Pex5	A	G	6: 124,405,183	S180P	probably benign	Het
Phf14	G	C	6: 11,992,062	G746R	probably damaging	Het
Pkm	T	A	9: 59,668,631	V110E	probably damaging	Het
Plekha6	T	G	1: 133,264,687	N78K	probably damaging	Het
Plxna2	G	A	1: 194,790,175	V1076I	probably benign	Het
Polq	C	A	16: 37,061,819	D1448E	probably damaging	Het
Pot1b	T	C	17: 55,687,895	T256A	probably benign	Het
Prkch	C	T	12: 73,702,764	T377I	possibly damaging	Het
Prl3c1	A	C	13: 27,199,185		probably benign	Het
Prl7b1	A	C	13: 27,602,772	V158G	possibly damaging	Het
Prss22	T	C	17: 23,993,981	S261G	probably damaging	Het
Psd	T	C	19: 46,321,102		probably benign	Het
Psg18	A	T	7: 18,353,377	Y119N	probably damaging	Het
Rbm6	T	G	9: 107,852,794	R218S	probably damaging	Het
Rnf213	T	A	11: 119,434,742	S1491T		Het
Rsf1	T	C	7: 97,661,925	S621P		Het
Runx1	C	A	16: 92,605,656	*466L	probably null	Het
Samd4	A	G	14: 47,016,678	I200V	probably benign	Het
Sdsl	C	T	5: 120,459,519	C241Y	probably benign	Het
Sepn1	T	C	4: 134,551,414		probably benign	Het
Setx	C	T	2: 29,145,690	P729L	possibly damaging	Het
Sf1	C	T	19: 6,368,366	Q55*	probably null	Het
Slc12a5	A	T	2: 164,993,691	N833I	probably damaging	Het
Slc1a4	T	C	11: 20,332,286	R63G	probably damaging	Het
Tmeff2	G	T	1: 51,181,837	A324S	probably benign	Het
Tmem217	A	G	17: 29,526,492	I88T	possibly damaging	Het
Tnfsf8	A	T	4: 63,860,878	I61N	probably benign	Het
Tpbgl	G	T	7: 99,625,567	A361E	probably damaging	Het
Trhde	T	A	10: 114,487,006	E667V	probably benign	Het
Unc13b	A	G	4: 43,263,568	T1598A	probably benign	Het
Vmn2r73	A	T	7: 85,858,302	C601S	probably benign	Het
Zfp873	C	A	10: 82,060,879	H481Q	probably damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATGACTAGCCAGCAGGTGC -3'
(R):5'- TTCTACCTCAAAGATGTCACTGG -3'

Sequencing Primer
(F):5'- GCGACTGGGTGATAGATAGAC -3'
(R):5'- TGGGACACTGGAGACACTGTTC -3'

Posted On

2021-07-30