Incidental Mutation 'G1Funyon:Aldh16a1'
ID 677067
Institutional Source Beutler Lab
Gene Symbol Aldh16a1
Ensembl Gene ENSMUSG00000007833
Gene Name aldehyde dehydrogenase 16 family, member A1
Synonyms 2410004H02Rik
MMRRC Submission 067789-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # G1Funyon (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 44791257-44804008 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44791406 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 790 (A790T)
Ref Sequence ENSEMBL: ENSMUSP00000148069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107815] [ENSMUST00000209963] [ENSMUST00000211169]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000107815
SMART Domains Protein: ENSMUSP00000103445
Gene: ENSMUSG00000007833

DomainStartEndE-ValueType
Pfam:Aldedh 48 488 3.8e-87 PFAM
Pfam:Aldedh 536 753 2.7e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209963
AA Change: A790T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000211169
AA Change: A100T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldehyde dehydrogenase superfamily. The family members act on aldehyde substrates and use nicotinamide adenine dinucleotide phosphate (NADP) as a cofactor. This gene is conserved in chimpanzee, dog, cow, mouse, rat, and zebrafish. The protein encoded by this gene interacts with maspardin, a protein that when truncated is responsible for Mast syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,120,364 (GRCm39) I374F probably benign Het
Anks1 A T 17: 28,278,554 (GRCm39) probably benign Het
Antxr2 T G 5: 98,125,538 (GRCm39) T240P probably benign Het
Arfgef1 A T 1: 10,250,058 (GRCm39) M945K probably damaging Het
Arhgef17 T C 7: 100,528,866 (GRCm39) T1591A probably benign Het
Aurka A G 2: 172,198,850 (GRCm39) S374P probably damaging Het
Bccip T C 7: 133,320,933 (GRCm39) S236P probably benign Het
Cacna1s T A 1: 136,001,179 (GRCm39) probably benign Het
Calm1 A G 12: 100,171,944 (GRCm39) E132G probably benign Het
Casz1 A G 4: 149,030,500 (GRCm39) D1173G probably damaging Het
Cdh17 A G 4: 11,795,659 (GRCm39) D413G probably damaging Het
Cfap57 A G 4: 118,450,271 (GRCm39) I617T possibly damaging Het
Csnka2ip A C 16: 64,299,354 (GRCm39) S337A unknown Het
Ddx60 A G 8: 62,453,631 (GRCm39) E1250G probably benign Het
Dlgap2 T A 8: 14,873,577 (GRCm39) S727T probably benign Het
Dpy19l1 T C 9: 24,396,407 (GRCm39) probably benign Het
Ebf2 A G 14: 67,476,431 (GRCm39) T134A possibly damaging Het
Echdc2 A T 4: 108,030,106 (GRCm39) M136L probably benign Het
Enpp2 A G 15: 54,714,803 (GRCm39) F598S probably benign Het
Extl3 A C 14: 65,313,733 (GRCm39) L483R probably damaging Het
Gcat T C 15: 78,920,089 (GRCm39) V227A possibly damaging Het
Hsf2 A G 10: 57,381,442 (GRCm39) D344G probably damaging Het
Ighm C T 12: 113,385,165 (GRCm39) G265D Het
Igsf9b T G 9: 27,246,035 (GRCm39) probably benign Het
Ints6 A G 14: 62,939,902 (GRCm39) V596A probably benign Het
Ints8 T C 4: 11,246,120 (GRCm39) E182G probably damaging Het
Iqgap2 A G 13: 95,818,659 (GRCm39) probably null Het
Kalrn G T 16: 34,177,470 (GRCm39) Q250K probably benign Het
Lrrc1 T A 9: 77,451,770 (GRCm39) N46Y probably damaging Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naa50 A G 16: 43,977,494 (GRCm39) N74S probably benign Het
Neb T C 2: 52,178,847 (GRCm39) N1303S probably benign Het
Nfs1 A T 2: 155,976,413 (GRCm39) C160* probably null Het
Or11g7 T A 14: 50,691,021 (GRCm39) S171T probably benign Het
Or52s1b T G 7: 102,822,280 (GRCm39) K188T probably damaging Het
Or5p52 A G 7: 107,502,833 (GRCm39) K303R probably benign Het
Or6c76 T C 10: 129,612,709 (GRCm39) S309P probably benign Het
Orm2 T C 4: 63,281,263 (GRCm39) F67S possibly damaging Het
Pex5 A G 6: 124,382,142 (GRCm39) S180P probably benign Het
Phf14 G C 6: 11,992,061 (GRCm39) G746R probably damaging Het
Pkm T A 9: 59,575,914 (GRCm39) V110E probably damaging Het
Plekha6 T G 1: 133,192,425 (GRCm39) N78K probably damaging Het
Plxna2 G A 1: 194,472,483 (GRCm39) V1076I probably benign Het
Polq C A 16: 36,882,181 (GRCm39) D1448E probably damaging Het
Pot1b T C 17: 55,994,895 (GRCm39) T256A probably benign Het
Prkch C T 12: 73,749,538 (GRCm39) T377I possibly damaging Het
Prl3c1 A C 13: 27,383,168 (GRCm39) probably benign Het
Prl7b1 A C 13: 27,786,755 (GRCm39) V158G possibly damaging Het
Prss22 T C 17: 24,212,955 (GRCm39) S261G probably damaging Het
Psd T C 19: 46,309,541 (GRCm39) probably benign Het
Psg18 A T 7: 18,087,302 (GRCm39) Y119N probably damaging Het
Rbm6 T G 9: 107,729,993 (GRCm39) R218S probably damaging Het
Rnf213 T A 11: 119,325,568 (GRCm39) S1491T Het
Rsf1 T C 7: 97,311,132 (GRCm39) S621P Het
Runx1 C A 16: 92,402,544 (GRCm39) *466L probably null Het
Samd4 A G 14: 47,254,135 (GRCm39) I200V probably benign Het
Sdsl C T 5: 120,597,584 (GRCm39) C241Y probably benign Het
Selenon T C 4: 134,278,725 (GRCm39) probably benign Het
Setx C T 2: 29,035,702 (GRCm39) P729L possibly damaging Het
Sf1 C T 19: 6,418,396 (GRCm39) Q55* probably null Het
Slc12a5 A T 2: 164,835,611 (GRCm39) N833I probably damaging Het
Slc1a4 T C 11: 20,282,286 (GRCm39) R63G probably damaging Het
Tmeff2 G T 1: 51,220,996 (GRCm39) A324S probably benign Het
Tmem217 A G 17: 29,745,466 (GRCm39) I88T possibly damaging Het
Tnfsf8 A T 4: 63,779,115 (GRCm39) I61N probably benign Het
Tpbgl G T 7: 99,274,774 (GRCm39) A361E probably damaging Het
Trhde T A 10: 114,322,911 (GRCm39) E667V probably benign Het
Unc13b A G 4: 43,263,568 (GRCm39) T1598A probably benign Het
Vmn2r73 A T 7: 85,507,510 (GRCm39) C601S probably benign Het
Zfp873 C A 10: 81,896,713 (GRCm39) H481Q probably damaging Het
Other mutations in Aldh16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Aldh16a1 APN 7 44,794,937 (GRCm39) missense probably benign 0.00
IGL01449:Aldh16a1 APN 7 44,791,391 (GRCm39) missense probably damaging 0.99
IGL01599:Aldh16a1 APN 7 44,791,517 (GRCm39) missense probably damaging 0.99
IGL02118:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02120:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02123:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02125:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02126:Aldh16a1 APN 7 44,795,459 (GRCm39) missense probably damaging 1.00
IGL02794:Aldh16a1 APN 7 44,795,018 (GRCm39) missense probably damaging 0.98
IGL03348:Aldh16a1 APN 7 44,791,399 (GRCm39) missense possibly damaging 0.85
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0242:Aldh16a1 UTSW 7 44,794,088 (GRCm39) missense probably damaging 1.00
R0305:Aldh16a1 UTSW 7 44,797,403 (GRCm39) missense probably damaging 1.00
R0532:Aldh16a1 UTSW 7 44,792,262 (GRCm39) missense probably damaging 1.00
R0550:Aldh16a1 UTSW 7 44,795,653 (GRCm39) splice site probably null
R0707:Aldh16a1 UTSW 7 44,793,931 (GRCm39) unclassified probably benign
R0801:Aldh16a1 UTSW 7 44,796,900 (GRCm39) missense probably benign 0.00
R1224:Aldh16a1 UTSW 7 44,791,471 (GRCm39) splice site probably null
R1371:Aldh16a1 UTSW 7 44,796,674 (GRCm39) missense possibly damaging 0.78
R1778:Aldh16a1 UTSW 7 44,796,732 (GRCm39) missense probably damaging 1.00
R2064:Aldh16a1 UTSW 7 44,796,585 (GRCm39) critical splice donor site probably null
R4616:Aldh16a1 UTSW 7 44,798,212 (GRCm39) intron probably benign
R4859:Aldh16a1 UTSW 7 44,796,731 (GRCm39) missense probably benign 0.10
R4928:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R5476:Aldh16a1 UTSW 7 44,791,493 (GRCm39) missense possibly damaging 0.89
R5591:Aldh16a1 UTSW 7 44,794,076 (GRCm39) missense probably null 0.82
R5647:Aldh16a1 UTSW 7 44,803,889 (GRCm39) missense probably benign 0.00
R5692:Aldh16a1 UTSW 7 44,797,223 (GRCm39) missense probably damaging 1.00
R5698:Aldh16a1 UTSW 7 44,803,831 (GRCm39) unclassified probably benign
R5879:Aldh16a1 UTSW 7 44,796,930 (GRCm39) nonsense probably null
R5890:Aldh16a1 UTSW 7 44,793,969 (GRCm39) missense probably benign 0.00
R6321:Aldh16a1 UTSW 7 44,799,189 (GRCm39) missense probably damaging 1.00
R6338:Aldh16a1 UTSW 7 44,791,385 (GRCm39) missense probably damaging 1.00
R6373:Aldh16a1 UTSW 7 44,795,695 (GRCm39) missense probably benign 0.00
R6497:Aldh16a1 UTSW 7 44,794,361 (GRCm39) missense possibly damaging 0.93
R6566:Aldh16a1 UTSW 7 44,792,651 (GRCm39) missense probably benign 0.22
R7248:Aldh16a1 UTSW 7 44,795,018 (GRCm39) missense probably damaging 0.98
R7303:Aldh16a1 UTSW 7 44,797,328 (GRCm39) missense probably damaging 1.00
R7467:Aldh16a1 UTSW 7 44,795,331 (GRCm39) missense probably benign 0.03
R7636:Aldh16a1 UTSW 7 44,796,955 (GRCm39) missense unknown
R7830:Aldh16a1 UTSW 7 44,795,649 (GRCm39) missense probably damaging 0.98
R8301:Aldh16a1 UTSW 7 44,791,406 (GRCm39) missense possibly damaging 0.80
R8444:Aldh16a1 UTSW 7 44,799,115 (GRCm39) missense probably benign 0.00
R8801:Aldh16a1 UTSW 7 44,791,438 (GRCm39) missense probably benign
R9011:Aldh16a1 UTSW 7 44,794,951 (GRCm39) missense probably damaging 0.98
R9187:Aldh16a1 UTSW 7 44,791,441 (GRCm39) missense probably damaging 0.99
R9620:Aldh16a1 UTSW 7 44,797,413 (GRCm39) nonsense probably null
Z1177:Aldh16a1 UTSW 7 44,795,327 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CAGTATTCTCCCAGGGTTGC -3'
(R):5'- CTAAGGAAGCAGCTGTTTGGC -3'

Sequencing Primer
(F):5'- TACTGGGCCACACATGAAG -3'
(R):5'- CTGTTTGGCAACTAAACCACTGG -3'
Posted On 2021-07-30