Incidental Mutation 'R8883:Fbh1'
ID 677088
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission 068689-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.447) question?
Stock # R8883 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11753922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 807 (F807L)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564] [ENSMUST00000131893]
AlphaFold Q8K2I9
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: F807L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: F807L

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131893
AA Change: F222L

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116392
Gene: ENSMUSG00000058594
AA Change: F222L

DomainStartEndE-ValueType
SCOP:d1pjr_1 63 141 5e-9 SMART
Meta Mutation Damage Score 0.1298 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,283,168 (GRCm39) S3197P probably benign Het
Arih2 A G 9: 108,486,992 (GRCm39) S315P probably damaging Het
Atp1b3 A T 9: 96,246,122 (GRCm39) L29Q probably damaging Het
Bsn G A 9: 107,990,227 (GRCm39) P1842S probably damaging Het
Ccnb1ip1 G C 14: 51,027,359 (GRCm39) P248A probably benign Het
Cep76 T C 18: 67,766,540 (GRCm39) Q262R probably benign Het
Cox10 T C 11: 63,884,775 (GRCm39) E210G probably damaging Het
Dcaf1 T G 9: 106,724,839 (GRCm39) probably benign Het
Dgki A T 6: 36,993,608 (GRCm39) D584E probably damaging Het
Evpl T C 11: 116,121,243 (GRCm39) E428G probably damaging Het
Fbxo11 A G 17: 88,305,044 (GRCm39) V533A Het
Fermt3 G T 19: 6,980,600 (GRCm39) D322E probably damaging Het
Fsip2 G T 2: 82,809,524 (GRCm39) V1948L possibly damaging Het
Gata4 T C 14: 63,442,204 (GRCm39) D206G probably benign Het
Gjd3 A G 11: 102,691,769 (GRCm39) V78A probably damaging Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Hmces G A 6: 87,910,396 (GRCm39) A269T probably benign Het
Kalrn A T 16: 33,814,025 (GRCm39) N2434K probably damaging Het
Kif1b A T 4: 149,361,342 (GRCm39) S49T probably benign Het
Kndc1 C T 7: 139,507,708 (GRCm39) S1222F possibly damaging Het
Lap3 C A 5: 45,669,272 (GRCm39) H474N probably benign Het
Ldlrad1 A G 4: 107,073,412 (GRCm39) Y149C probably damaging Het
Lsm8 T C 6: 18,851,747 (GRCm39) V62A probably benign Het
Map3k14 T G 11: 103,130,278 (GRCm39) Q213P probably benign Het
Mboat2 T G 12: 25,009,033 (GRCm39) H478Q Het
Mepce C A 5: 137,784,779 (GRCm39) probably benign Het
Mical1 G A 10: 41,355,636 (GRCm39) R233H Het
Muc2 A G 7: 141,287,469 (GRCm39) H216R probably damaging Het
Ntmt1 G A 2: 30,712,466 (GRCm39) A170T probably benign Het
Or2ag15 A G 7: 106,340,274 (GRCm39) I289T possibly damaging Het
Or2d3 A C 7: 106,490,536 (GRCm39) M260R probably damaging Het
Or5w17 T A 2: 87,583,838 (GRCm39) L166F probably damaging Het
Or8g19 A G 9: 39,056,083 (GRCm39) H229R probably benign Het
Pebp4 G T 14: 70,085,098 (GRCm39) C52F probably damaging Het
Pigm T A 1: 172,205,085 (GRCm39) Y274N probably damaging Het
Pik3r6 T C 11: 68,424,468 (GRCm39) S358P probably benign Het
Plekhd1 T C 12: 80,767,368 (GRCm39) I252T probably benign Het
Prss3b G T 6: 41,009,305 (GRCm39) Y176* probably null Het
Racgap1 A G 15: 99,526,540 (GRCm39) V341A probably benign Het
Rprd1a T C 18: 24,640,260 (GRCm39) D172G possibly damaging Het
Spg11 T C 2: 121,943,561 (GRCm39) D197G probably damaging Het
Spmap2 T C 10: 79,412,474 (GRCm39) D339G probably benign Het
Spta1 A T 1: 174,021,145 (GRCm39) K574N possibly damaging Het
Srrd A T 5: 112,487,790 (GRCm39) F130L possibly damaging Het
Stim1 A T 7: 102,080,257 (GRCm39) H547L unknown Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Tap1 T C 17: 34,406,867 (GRCm39) V5A unknown Het
Tent5c C A 3: 100,379,707 (GRCm39) A350S probably benign Het
Usp45 G A 4: 21,825,006 (GRCm39) G586D probably damaging Het
Vps13c G T 9: 67,855,479 (GRCm39) A2515S probably benign Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Zfyve28 T C 5: 34,375,211 (GRCm39) probably null Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R0972:Fbh1 UTSW 2 11,768,899 (GRCm39) splice site probably benign
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7361:Fbh1 UTSW 2 11,751,887 (GRCm39) missense probably damaging 1.00
R7460:Fbh1 UTSW 2 11,761,496 (GRCm39) missense probably benign 0.38
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8000:Fbh1 UTSW 2 11,772,100 (GRCm39) missense probably benign 0.21
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9306:Fbh1 UTSW 2 11,772,387 (GRCm39) missense probably benign 0.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAAGGTAACAGCCACTTTC -3'
(R):5'- GGCAGCTGTACACTCCATCTTC -3'

Sequencing Primer
(F):5'- GGAAGGTAACAGCCACTTTCCTTAC -3'
(R):5'- GTACACTCCATCTTCTCTGCGGTAC -3'
Posted On 2021-08-02