Incidental Mutation 'R8883:Stim1'
ID 677105
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8883 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102431050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 547 (H547L)
Ref Sequence ENSEMBL: ENSMUSP00000147443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209255
AA Change: H547L
Predicted Effect probably benign
Transcript: ENSMUST00000211058
Predicted Effect probably benign
Transcript: ENSMUST00000211457
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G T 6: 41,032,371 Y176* probably null Het
Abca13 T C 11: 9,333,168 S3197P probably benign Het
Arih2 A G 9: 108,609,793 S315P probably damaging Het
Atp1b3 A T 9: 96,364,069 L29Q probably damaging Het
Bsn G A 9: 108,113,028 P1842S probably damaging Het
Ccnb1ip1 G C 14: 50,789,902 P248A probably benign Het
Cep76 T C 18: 67,633,470 Q262R probably benign Het
Cox10 T C 11: 63,993,949 E210G probably damaging Het
Dcaf1 T G 9: 106,847,640 probably benign Het
Dgki A T 6: 37,016,673 D584E probably damaging Het
Evpl T C 11: 116,230,417 E428G probably damaging Het
Fam46c C A 3: 100,472,391 A350S probably benign Het
Fbxo11 A G 17: 87,997,616 V533A Het
Fbxo18 A G 2: 11,749,111 F807L probably benign Het
Fermt3 G T 19: 7,003,232 D322E probably damaging Het
Fsip2 G T 2: 82,979,180 V1948L possibly damaging Het
Gata4 T C 14: 63,204,755 D206G probably benign Het
Gjc1 A G 11: 102,800,943 V78A probably damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Hmces G A 6: 87,933,414 A269T probably benign Het
Kalrn A T 16: 33,993,655 N2434K probably damaging Het
Kif1b A T 4: 149,276,885 S49T probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lap3 C A 5: 45,511,930 H474N probably benign Het
Ldlrad1 A G 4: 107,216,215 Y149C probably damaging Het
Lsm8 T C 6: 18,851,748 V62A probably benign Het
Map3k14 T G 11: 103,239,452 Q213P probably benign Het
Mboat2 T G 12: 24,959,034 H478Q Het
Mepce C A 5: 137,786,517 probably benign Het
Mical1 G A 10: 41,479,640 R233H Het
Muc2 A G 7: 141,700,900 H216R probably damaging Het
Ntmt1 G A 2: 30,822,454 A170T probably benign Het
Olfr1141 T A 2: 87,753,494 L166F probably damaging Het
Olfr27 A G 9: 39,144,787 H229R probably benign Het
Olfr697 A G 7: 106,741,067 I289T possibly damaging Het
Olfr707 A C 7: 106,891,329 M260R probably damaging Het
Pebp4 G T 14: 69,847,649 C52F probably damaging Het
Pigm T A 1: 172,377,518 Y274N probably damaging Het
Pik3r6 T C 11: 68,533,642 S358P probably benign Het
Plekhd1 T C 12: 80,720,594 I252T probably benign Het
Racgap1 A G 15: 99,628,659 V341A probably benign Het
Rprd1a T C 18: 24,507,203 D172G possibly damaging Het
Spg11 T C 2: 122,113,080 D197G probably damaging Het
Spta1 A T 1: 174,193,579 K574N possibly damaging Het
Srrd A T 5: 112,339,924 F130L possibly damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tap1 T C 17: 34,187,893 V5A unknown Het
Theg T C 10: 79,576,640 D339G probably benign Het
Usp45 G A 4: 21,825,006 G586D probably damaging Het
Vps13c G T 9: 67,948,197 A2515S probably benign Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfyve28 T C 5: 34,217,867 probably null Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TACATGCTTGCCTGCACACC -3'
(R):5'- TCAGGGTAGGGATCCATCTG -3'

Sequencing Primer
(F):5'- TGCCTGCACACCACTTGG -3'
(R):5'- TCCATCTGAAGGAAATAGGAAGTGC -3'
Posted On 2021-08-02