Incidental Mutation 'R8883:Olfr707'
ID 677107
Institutional Source Beutler Lab
Gene Symbol Olfr707
Ensembl Gene ENSMUSG00000069390
Gene Name olfactory receptor 707
Synonyms MOR260-8P, GA_x6K02T2PBJ9-9276470-9275547
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R8883 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 106890446-106901241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 106891329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 260 (M260R)
Ref Sequence ENSEMBL: ENSMUSP00000147446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
AlphaFold K7N662
Predicted Effect probably damaging
Transcript: ENSMUST00000088687
AA Change: M260R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390
AA Change: M260R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208759
AA Change: M260R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209025
Predicted Effect probably damaging
Transcript: ENSMUST00000210644
AA Change: M260R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213251
AA Change: M260R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213918
Predicted Effect probably damaging
Transcript: ENSMUST00000214112
AA Change: M260R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik G T 6: 41,032,371 Y176* probably null Het
Abca13 T C 11: 9,333,168 S3197P probably benign Het
Arih2 A G 9: 108,609,793 S315P probably damaging Het
Atp1b3 A T 9: 96,364,069 L29Q probably damaging Het
Bsn G A 9: 108,113,028 P1842S probably damaging Het
Ccnb1ip1 G C 14: 50,789,902 P248A probably benign Het
Cep76 T C 18: 67,633,470 Q262R probably benign Het
Cox10 T C 11: 63,993,949 E210G probably damaging Het
Dcaf1 T G 9: 106,847,640 probably benign Het
Dgki A T 6: 37,016,673 D584E probably damaging Het
Evpl T C 11: 116,230,417 E428G probably damaging Het
Fam46c C A 3: 100,472,391 A350S probably benign Het
Fbxo11 A G 17: 87,997,616 V533A Het
Fbxo18 A G 2: 11,749,111 F807L probably benign Het
Fermt3 G T 19: 7,003,232 D322E probably damaging Het
Fsip2 G T 2: 82,979,180 V1948L possibly damaging Het
Gata4 T C 14: 63,204,755 D206G probably benign Het
Gjc1 A G 11: 102,800,943 V78A probably damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Hmces G A 6: 87,933,414 A269T probably benign Het
Kalrn A T 16: 33,993,655 N2434K probably damaging Het
Kif1b A T 4: 149,276,885 S49T probably benign Het
Kndc1 C T 7: 139,927,795 S1222F possibly damaging Het
Lap3 C A 5: 45,511,930 H474N probably benign Het
Ldlrad1 A G 4: 107,216,215 Y149C probably damaging Het
Lsm8 T C 6: 18,851,748 V62A probably benign Het
Map3k14 T G 11: 103,239,452 Q213P probably benign Het
Mboat2 T G 12: 24,959,034 H478Q Het
Mepce C A 5: 137,786,517 probably benign Het
Mical1 G A 10: 41,479,640 R233H Het
Muc2 A G 7: 141,700,900 H216R probably damaging Het
Ntmt1 G A 2: 30,822,454 A170T probably benign Het
Olfr1141 T A 2: 87,753,494 L166F probably damaging Het
Olfr27 A G 9: 39,144,787 H229R probably benign Het
Olfr697 A G 7: 106,741,067 I289T possibly damaging Het
Pebp4 G T 14: 69,847,649 C52F probably damaging Het
Pigm T A 1: 172,377,518 Y274N probably damaging Het
Pik3r6 T C 11: 68,533,642 S358P probably benign Het
Plekhd1 T C 12: 80,720,594 I252T probably benign Het
Racgap1 A G 15: 99,628,659 V341A probably benign Het
Rprd1a T C 18: 24,507,203 D172G possibly damaging Het
Spg11 T C 2: 122,113,080 D197G probably damaging Het
Spta1 A T 1: 174,193,579 K574N possibly damaging Het
Srrd A T 5: 112,339,924 F130L possibly damaging Het
Stim1 A T 7: 102,431,050 H547L unknown Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Tap1 T C 17: 34,187,893 V5A unknown Het
Theg T C 10: 79,576,640 D339G probably benign Het
Usp45 G A 4: 21,825,006 G586D probably damaging Het
Vps13c G T 9: 67,948,197 A2515S probably benign Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfyve28 T C 5: 34,217,867 probably null Het
Other mutations in Olfr707
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr707 APN 7 106891329 missense probably damaging 1.00
R1539:Olfr707 UTSW 7 106891276 missense probably damaging 1.00
R1768:Olfr707 UTSW 7 106891977 splice site probably null
R1768:Olfr707 UTSW 7 106891978 missense probably damaging 0.97
R4367:Olfr707 UTSW 7 106891360 small deletion probably benign
R4542:Olfr707 UTSW 7 106891360 small deletion probably benign
R4874:Olfr707 UTSW 7 106891435 missense probably benign 0.28
R6164:Olfr707 UTSW 7 106891928 nonsense probably null
R8124:Olfr707 UTSW 7 106891881 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AAATGGTAACTGGCTTCAAATTCCC -3'
(R):5'- GGCATCGGCAGATACATACAG -3'

Sequencing Primer
(F):5'- CCCATGGCCCTGAACTATTTTAAAG -3'
(R):5'- CACAGAGATGGCGATCTTTGC -3'
Posted On 2021-08-02