Incidental Mutation 'R8884:Aasdh'
ID677155
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R8884 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76891794 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 223 (S223P)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000146570]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069709
AA Change: S223P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: S223P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000120963
AA Change: S223P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: S223P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
AA Change: S223P

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923
AA Change: S223P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146570
AA Change: S223P

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923
AA Change: S223P

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,488 F168Y probably damaging Het
4932415D10Rik T A 10: 82,283,652 H4508L probably damaging Het
4932438H23Rik T C 16: 91,055,849 Y133C probably damaging Het
Abca8a T C 11: 110,074,115 D453G possibly damaging Het
Acsl6 T A 11: 54,345,902 F541I probably damaging Het
Agfg1 A T 1: 82,882,389 K326* probably null Het
Aldh1l2 T C 10: 83,508,677 N448S probably benign Het
Alx4 A G 2: 93,643,010 K118E possibly damaging Het
Atp9b T A 18: 80,795,347 T451S Het
B4galt6 A T 18: 20,689,015 N307K probably benign Het
Cacna1s G A 1: 136,115,243 M1569I probably benign Het
Cacng6 C T 7: 3,430,468 T121I probably damaging Het
Cdc5l C A 17: 45,433,541 probably benign Het
Cdh7 A T 1: 110,100,130 D535V probably damaging Het
Chrnb3 T C 8: 27,393,918 F228L possibly damaging Het
Clca1 A T 3: 145,013,996 D404E probably benign Het
Commd8 G A 5: 72,168,171 probably benign Het
Cpn1 T A 19: 43,966,176 Q337L possibly damaging Het
Dctn6 T C 8: 34,090,779 T180A probably benign Het
Ddx60 A G 8: 61,994,519 E1180G possibly damaging Het
Dock4 T A 12: 40,806,885 L1239Q probably damaging Het
Dopey2 T C 16: 93,759,662 I469T probably benign Het
Enpep A T 3: 129,321,403 I240N possibly damaging Het
Fat3 G A 9: 16,029,984 T1337I probably damaging Het
Fbxw13 T A 9: 109,181,401 M390L probably benign Het
Fgr C T 4: 132,986,298 P46S probably benign Het
Galnt1 T A 18: 24,267,584 M249K probably benign Het
Gm40460 A T 7: 142,240,818 C87* probably null Het
Hcn4 C T 9: 58,853,422 R417C unknown Het
Insr T C 8: 3,155,679 N1370S probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif14 G A 1: 136,486,351 E722K Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc16 G A 9: 18,644,200 T3599I unknown Het
Muc5b T C 7: 141,849,419 F706L unknown Het
Nbea A T 3: 55,805,299 M2119K probably benign Het
Olfr46 C T 7: 140,610,703 P171L probably damaging Het
Olfr538 A T 7: 140,574,311 T53S probably benign Het
Paip1 G A 13: 119,438,017 V83I probably damaging Het
Pdcd1lg2 G T 19: 29,445,918 probably null Het
Pde7a G A 3: 19,227,694 A464V probably benign Het
Pfkfb2 A G 1: 130,706,476 F155L probably damaging Het
Pimreg A G 11: 72,045,687 D192G possibly damaging Het
Prkd3 T C 17: 78,974,764 D320G probably damaging Het
Rgs7 A G 1: 175,153,164 V98A probably benign Het
Ric3 C T 7: 109,038,481 G356D probably benign Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sez6l T C 5: 112,475,044 T214A probably damaging Het
Sipa1l1 T G 12: 82,363,097 V595G probably damaging Het
Spta1 G T 1: 174,217,688 probably null Het
Syne1 T G 10: 5,231,822 Q4171P possibly damaging Het
Tgfb2 G A 1: 186,632,710 T232I probably damaging Het
Tmem175 A G 5: 108,646,461 S486G probably benign Het
Tmprss15 A G 16: 79,024,769 V466A probably benign Het
Ttc14 A G 3: 33,800,547 S8G unknown Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Vmn1r44 T C 6: 89,893,476 L68P probably damaging Het
Vmn2r37 T G 7: 9,215,917 L489F probably benign Het
Vmn2r52 T A 7: 10,158,807 T802S probably damaging Het
Wsb2 T A 5: 117,370,704 F68I probably benign Het
Zbtb8os T C 4: 129,343,131 V113A probably benign Het
Zfp354a A T 11: 51,059,978 probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 splice site probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7069:Aasdh UTSW 5 76876356 missense probably benign 0.03
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
R8425:Aasdh UTSW 5 76886277 missense possibly damaging 0.49
R9028:Aasdh UTSW 5 76876130 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACTCTGTGGCGGGAAAAG -3'
(R):5'- GAACCATGAAAACTTTTCGTCTCC -3'

Sequencing Primer
(F):5'- AGAGAATGTCAGCTAATTTTGATGG -3'
(R):5'- TCCATGATGGCACTGCTG -3'
Posted On2021-08-02