Mutagenetix > Incidental Mutation

Incidental Mutation 'R8884:Ddx60'

677173

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.170) question?

Stock #

R8884 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 61994519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1180 (E1180G)

Ref Sequence

ENSEMBL: ENSMUSP00000091197 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]

AlphaFold

E9PZQ1

Predicted Effect

probably benign
Transcript: ENSMUST00000070631
AA Change: E1179G

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: E1179G

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: E1180G

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: E1180G

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

98% (65/66)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,737,488	F168Y	probably damaging	Het
4932415D10Rik	T	A	10: 82,283,652	H4508L	probably damaging	Het
4932438H23Rik	T	C	16: 91,055,849	Y133C	probably damaging	Het
Aasdh	A	G	5: 76,891,794	S223P	possibly damaging	Het
Abca8a	T	C	11: 110,074,115	D453G	possibly damaging	Het
Acsl6	T	A	11: 54,345,902	F541I	probably damaging	Het
Agfg1	A	T	1: 82,882,389	K326*	probably null	Het
Aldh1l2	T	C	10: 83,508,677	N448S	probably benign	Het
Alx4	A	G	2: 93,643,010	K118E	possibly damaging	Het
Atp9b	T	A	18: 80,795,347	T451S		Het
B4galt6	A	T	18: 20,689,015	N307K	probably benign	Het
Cacna1s	G	A	1: 136,115,243	M1569I	probably benign	Het
Cacng6	C	T	7: 3,430,468	T121I	probably damaging	Het
Cdc5l	C	A	17: 45,433,541		probably benign	Het
Cdh7	A	T	1: 110,100,130	D535V	probably damaging	Het
Chrnb3	T	C	8: 27,393,918	F228L	possibly damaging	Het
Clca1	A	T	3: 145,013,996	D404E	probably benign	Het
Commd8	G	A	5: 72,168,171		probably benign	Het
Cpn1	T	A	19: 43,966,176	Q337L	possibly damaging	Het
Dctn6	T	C	8: 34,090,779	T180A	probably benign	Het
Dock4	T	A	12: 40,806,885	L1239Q	probably damaging	Het
Dopey2	T	C	16: 93,759,662	I469T	probably benign	Het
Enpep	A	T	3: 129,321,403	I240N	possibly damaging	Het
Fat3	G	A	9: 16,029,984	T1337I	probably damaging	Het
Fbxw13	T	A	9: 109,181,401	M390L	probably benign	Het
Fgr	C	T	4: 132,986,298	P46S	probably benign	Het
Galnt1	T	A	18: 24,267,584	M249K	probably benign	Het
Gm40460	A	T	7: 142,240,818	C87*	probably null	Het
Hcn4	C	T	9: 58,853,422	R417C	unknown	Het
Insr	T	C	8: 3,155,679	N1370S	probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kif14	G	A	1: 136,486,351	E722K		Het
Larp6	G	A	9: 60,713,399	G65E		Het
Mindy4	T	C	6: 55,278,238	L567P	probably benign	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Muc16	G	A	9: 18,644,200	T3599I	unknown	Het
Muc5b	T	C	7: 141,849,419	F706L	unknown	Het
Nbea	A	T	3: 55,805,299	M2119K	probably benign	Het
Olfr46	C	T	7: 140,610,703	P171L	probably damaging	Het
Olfr538	A	T	7: 140,574,311	T53S	probably benign	Het
Paip1	G	A	13: 119,438,017	V83I	probably damaging	Het
Pdcd1lg2	G	T	19: 29,445,918		probably null	Het
Pde7a	G	A	3: 19,227,694	A464V	probably benign	Het
Pfkfb2	A	G	1: 130,706,476	F155L	probably damaging	Het
Pimreg	A	G	11: 72,045,687	D192G	possibly damaging	Het
Prkd3	T	C	17: 78,974,764	D320G	probably damaging	Het
Rgs7	A	G	1: 175,153,164	V98A	probably benign	Het
Ric3	C	T	7: 109,038,481	G356D	probably benign	Het
Rsph4a	T	C	10: 33,905,844		probably benign	Het
Ryr2	G	A	13: 11,779,266	T942I	probably benign	Het
Sez6l	T	C	5: 112,475,044	T214A	probably damaging	Het
Sipa1l1	T	G	12: 82,363,097	V595G	probably damaging	Het
Spta1	G	T	1: 174,217,688		probably null	Het
Ssbp2	A	G	13: 91,688,870		probably benign	Het
Syne1	T	G	10: 5,231,822	Q4171P	possibly damaging	Het
Tgfb2	G	A	1: 186,632,710	T232I	probably damaging	Het
Tmem175	A	G	5: 108,646,461	S486G	probably benign	Het
Tmprss15	A	G	16: 79,024,769	V466A	probably benign	Het
Treh	C	G	9: 44,684,503		probably benign	Het
Ttc14	A	G	3: 33,800,547	S8G	unknown	Het
Ttc32	T	A	12: 9,038,083	D103E	probably benign	Het
Vmn1r44	T	C	6: 89,893,476	L68P	probably damaging	Het
Vmn2r37	T	G	7: 9,215,917	L489F	probably benign	Het
Vmn2r52	T	A	7: 10,158,807	T802S	probably damaging	Het
Wsb2	T	A	5: 117,370,704	F68I	probably benign	Het
Zbtb8os	T	C	4: 129,343,131	V113A	probably benign	Het
Zfp354a	A	T	11: 51,059,978		probably benign	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
Scatter	UTSW	8	62021314	missense	possibly damaging	0.80
shotgun	UTSW	8	62037067	missense	probably benign	0.28
splay	UTSW	8	62021309	missense	possibly damaging	0.80
G1Funyon:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5815:Ddx60	UTSW	8	61963722	missense	probably damaging	0.98
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
R8826:Ddx60	UTSW	8	61945956	missense	probably benign	0.02
R8829:Ddx60	UTSW	8	61940661	missense	probably damaging	1.00
R8881:Ddx60	UTSW	8	62021309	missense	possibly damaging	0.80
R8990:Ddx60	UTSW	8	61974134	nonsense	probably null
R9122:Ddx60	UTSW	8	61989864	missense	probably benign	0.16
R9225:Ddx60	UTSW	8	62017841	missense	probably benign	0.36
R9278:Ddx60	UTSW	8	61977978	missense	possibly damaging	0.83
R9293:Ddx60	UTSW	8	62009960	missense	possibly damaging	0.89
R9405:Ddx60	UTSW	8	61972214	missense	probably benign	0.03
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GTCCAGATCTGTAAGCCTAACTGG -3'
(R):5'- GGTCACTTGTCTTTACCCAGTT -3'

Sequencing Primer
(F):5'- GGGGGCCAGTCTCATTCAAATTAC -3'
(R):5'- GTCTTTACCCAGTTCTCCCTCTG -3'

Posted On

2021-08-02