Incidental Mutation 'R8884:Aldh1l2'
ID 677181
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8884 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83508677 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 448 (N448S)
Ref Sequence ENSEMBL: ENSMUSP00000020497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect probably benign
Transcript: ENSMUST00000020497
AA Change: N448S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: N448S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146640
AA Change: N335S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: N335S

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,488 F168Y probably damaging Het
4932415D10Rik T A 10: 82,283,652 H4508L probably damaging Het
4932438H23Rik T C 16: 91,055,849 Y133C probably damaging Het
Aasdh A G 5: 76,891,794 S223P possibly damaging Het
Abca8a T C 11: 110,074,115 D453G possibly damaging Het
Acsl6 T A 11: 54,345,902 F541I probably damaging Het
Agfg1 A T 1: 82,882,389 K326* probably null Het
Alx4 A G 2: 93,643,010 K118E possibly damaging Het
Atp9b T A 18: 80,795,347 T451S Het
B4galt6 A T 18: 20,689,015 N307K probably benign Het
Cacna1s G A 1: 136,115,243 M1569I probably benign Het
Cacng6 C T 7: 3,430,468 T121I probably damaging Het
Cdc5l C A 17: 45,433,541 probably benign Het
Cdh7 A T 1: 110,100,130 D535V probably damaging Het
Chrnb3 T C 8: 27,393,918 F228L possibly damaging Het
Clca1 A T 3: 145,013,996 D404E probably benign Het
Commd8 G A 5: 72,168,171 probably benign Het
Cpn1 T A 19: 43,966,176 Q337L possibly damaging Het
Dctn6 T C 8: 34,090,779 T180A probably benign Het
Ddx60 A G 8: 61,994,519 E1180G possibly damaging Het
Dock4 T A 12: 40,806,885 L1239Q probably damaging Het
Dopey2 T C 16: 93,759,662 I469T probably benign Het
Enpep A T 3: 129,321,403 I240N possibly damaging Het
Fat3 G A 9: 16,029,984 T1337I probably damaging Het
Fbxw13 T A 9: 109,181,401 M390L probably benign Het
Fgr C T 4: 132,986,298 P46S probably benign Het
Galnt1 T A 18: 24,267,584 M249K probably benign Het
Gm40460 A T 7: 142,240,818 C87* probably null Het
Hcn4 C T 9: 58,853,422 R417C unknown Het
Insr T C 8: 3,155,679 N1370S probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif14 G A 1: 136,486,351 E722K Het
Larp6 G A 9: 60,713,399 G65E Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc16 G A 9: 18,644,200 T3599I unknown Het
Muc5b T C 7: 141,849,419 F706L unknown Het
Nbea A T 3: 55,805,299 M2119K probably benign Het
Olfr46 C T 7: 140,610,703 P171L probably damaging Het
Olfr538 A T 7: 140,574,311 T53S probably benign Het
Paip1 G A 13: 119,438,017 V83I probably damaging Het
Pdcd1lg2 G T 19: 29,445,918 probably null Het
Pde7a G A 3: 19,227,694 A464V probably benign Het
Pfkfb2 A G 1: 130,706,476 F155L probably damaging Het
Pimreg A G 11: 72,045,687 D192G possibly damaging Het
Prkd3 T C 17: 78,974,764 D320G probably damaging Het
Rgs7 A G 1: 175,153,164 V98A probably benign Het
Ric3 C T 7: 109,038,481 G356D probably benign Het
Rsph4a T C 10: 33,905,844 probably benign Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sez6l T C 5: 112,475,044 T214A probably damaging Het
Sipa1l1 T G 12: 82,363,097 V595G probably damaging Het
Spta1 G T 1: 174,217,688 probably null Het
Ssbp2 A G 13: 91,688,870 probably benign Het
Syne1 T G 10: 5,231,822 Q4171P possibly damaging Het
Tgfb2 G A 1: 186,632,710 T232I probably damaging Het
Tmem175 A G 5: 108,646,461 S486G probably benign Het
Tmprss15 A G 16: 79,024,769 V466A probably benign Het
Treh C G 9: 44,684,503 probably benign Het
Ttc14 A G 3: 33,800,547 S8G unknown Het
Ttc32 T A 12: 9,038,083 D103E probably benign Het
Vmn1r44 T C 6: 89,893,476 L68P probably damaging Het
Vmn2r37 T G 7: 9,215,917 L489F probably benign Het
Vmn2r52 T A 7: 10,158,807 T802S probably damaging Het
Wsb2 T A 5: 117,370,704 F68I probably benign Het
Zbtb8os T C 4: 129,343,131 V113A probably benign Het
Zfp354a A T 11: 51,059,978 probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83506642 missense possibly damaging 0.94
R9117:Aldh1l2 UTSW 10 83506681 missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCACACAGGGATCTGCTAG -3'
(R):5'- AGCTGACCTCTTTCCACATTAGTG -3'

Sequencing Primer
(F):5'- AGGGATCTGCTAGGCACTGATC -3'
(R):5'- GGTCAGTATATGTCACCAGATGCC -3'
Posted On 2021-08-02