Incidental Mutation 'R8884:Ttc32'
ID 677186
Institutional Source Beutler Lab
Gene Symbol Ttc32
Ensembl Gene ENSMUSG00000066637
Gene Name tetratricopeptide repeat domain 32
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8884 (G1)
Quality Score 224.009
Status Validated
Chromosome 12
Chromosomal Location 9029997-9041988 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9038083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 103 (D103E)
Ref Sequence ENSEMBL: ENSMUSP00000152004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085741] [ENSMUST00000219470] [ENSMUST00000219488]
AlphaFold Q9DAC7
Predicted Effect probably benign
Transcript: ENSMUST00000085741
SMART Domains Protein: ENSMUSP00000082891
Gene: ENSMUSG00000066637

DomainStartEndE-ValueType
Pfam:TPR_9 12 58 1.2e-2 PFAM
Pfam:TPR_12 51 121 1e-9 PFAM
Pfam:TPR_11 53 120 1.2e-14 PFAM
Pfam:TPR_1 55 88 3.5e-6 PFAM
Pfam:TPR_9 70 134 4.9e-7 PFAM
Pfam:TPR_1 90 122 1e-10 PFAM
Pfam:TPR_2 91 122 8.3e-11 PFAM
Pfam:TPR_8 91 122 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219470
Predicted Effect probably benign
Transcript: ENSMUST00000219488
AA Change: D103E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (65/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,737,488 F168Y probably damaging Het
4932415D10Rik T A 10: 82,283,652 H4508L probably damaging Het
4932438H23Rik T C 16: 91,055,849 Y133C probably damaging Het
Aasdh A G 5: 76,891,794 S223P possibly damaging Het
Abca8a T C 11: 110,074,115 D453G possibly damaging Het
Acsl6 T A 11: 54,345,902 F541I probably damaging Het
Agfg1 A T 1: 82,882,389 K326* probably null Het
Aldh1l2 T C 10: 83,508,677 N448S probably benign Het
Alx4 A G 2: 93,643,010 K118E possibly damaging Het
Atp9b T A 18: 80,795,347 T451S Het
B4galt6 A T 18: 20,689,015 N307K probably benign Het
Cacna1s G A 1: 136,115,243 M1569I probably benign Het
Cacng6 C T 7: 3,430,468 T121I probably damaging Het
Cdc5l C A 17: 45,433,541 probably benign Het
Cdh7 A T 1: 110,100,130 D535V probably damaging Het
Chrnb3 T C 8: 27,393,918 F228L possibly damaging Het
Clca1 A T 3: 145,013,996 D404E probably benign Het
Commd8 G A 5: 72,168,171 probably benign Het
Cpn1 T A 19: 43,966,176 Q337L possibly damaging Het
Dctn6 T C 8: 34,090,779 T180A probably benign Het
Ddx60 A G 8: 61,994,519 E1180G possibly damaging Het
Dock4 T A 12: 40,806,885 L1239Q probably damaging Het
Dopey2 T C 16: 93,759,662 I469T probably benign Het
Enpep A T 3: 129,321,403 I240N possibly damaging Het
Fat3 G A 9: 16,029,984 T1337I probably damaging Het
Fbxw13 T A 9: 109,181,401 M390L probably benign Het
Fgr C T 4: 132,986,298 P46S probably benign Het
Galnt1 T A 18: 24,267,584 M249K probably benign Het
Gm40460 A T 7: 142,240,818 C87* probably null Het
Hcn4 C T 9: 58,853,422 R417C unknown Het
Insr T C 8: 3,155,679 N1370S probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kif14 G A 1: 136,486,351 E722K Het
Larp6 G A 9: 60,713,399 G65E Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Muc16 G A 9: 18,644,200 T3599I unknown Het
Muc5b T C 7: 141,849,419 F706L unknown Het
Nbea A T 3: 55,805,299 M2119K probably benign Het
Olfr46 C T 7: 140,610,703 P171L probably damaging Het
Olfr538 A T 7: 140,574,311 T53S probably benign Het
Paip1 G A 13: 119,438,017 V83I probably damaging Het
Pdcd1lg2 G T 19: 29,445,918 probably null Het
Pde7a G A 3: 19,227,694 A464V probably benign Het
Pfkfb2 A G 1: 130,706,476 F155L probably damaging Het
Pimreg A G 11: 72,045,687 D192G possibly damaging Het
Prkd3 T C 17: 78,974,764 D320G probably damaging Het
Rgs7 A G 1: 175,153,164 V98A probably benign Het
Ric3 C T 7: 109,038,481 G356D probably benign Het
Rsph4a T C 10: 33,905,844 probably benign Het
Ryr2 G A 13: 11,779,266 T942I probably benign Het
Sez6l T C 5: 112,475,044 T214A probably damaging Het
Sipa1l1 T G 12: 82,363,097 V595G probably damaging Het
Spta1 G T 1: 174,217,688 probably null Het
Ssbp2 A G 13: 91,688,870 probably benign Het
Syne1 T G 10: 5,231,822 Q4171P possibly damaging Het
Tgfb2 G A 1: 186,632,710 T232I probably damaging Het
Tmem175 A G 5: 108,646,461 S486G probably benign Het
Tmprss15 A G 16: 79,024,769 V466A probably benign Het
Treh C G 9: 44,684,503 probably benign Het
Ttc14 A G 3: 33,800,547 S8G unknown Het
Vmn1r44 T C 6: 89,893,476 L68P probably damaging Het
Vmn2r37 T G 7: 9,215,917 L489F probably benign Het
Vmn2r52 T A 7: 10,158,807 T802S probably damaging Het
Wsb2 T A 5: 117,370,704 F68I probably benign Het
Zbtb8os T C 4: 129,343,131 V113A probably benign Het
Zfp354a A T 11: 51,059,978 probably benign Het
Other mutations in Ttc32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Ttc32 APN 12 9034953 missense probably damaging 1.00
IGL02809:Ttc32 APN 12 9035879 missense possibly damaging 0.53
R0012:Ttc32 UTSW 12 9035897 missense possibly damaging 0.96
R1769:Ttc32 UTSW 12 9035073 missense possibly damaging 0.85
R5888:Ttc32 UTSW 12 9035870 missense possibly damaging 0.53
R7787:Ttc32 UTSW 12 9038083 missense probably benign 0.00
R8061:Ttc32 UTSW 12 9034953 missense probably damaging 1.00
R8968:Ttc32 UTSW 12 9030187 missense probably benign
Z1176:Ttc32 UTSW 12 9035089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTAAGATCAACCCTGCC -3'
(R):5'- TCATGGACAGCATTCAGTTCC -3'

Sequencing Primer
(F):5'- GATCAACCCTGCCTCCTCTTAAAG -3'
(R):5'- GGACAGCATTCAGTTCCAGACTTG -3'
Posted On 2021-08-02