Incidental Mutation 'T0975:Dpep1'
ID67722
Institutional Source Beutler Lab
Gene Symbol Dpep1
Ensembl Gene ENSMUSG00000019278
Gene Namedipeptidase 1 (renal)
SynonymsMBD
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #T0975 (G3) of strain 714
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location123186242-123201812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123200988 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 388 (S388C)
Ref Sequence ENSEMBL: ENSMUSP00000019422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000759] [ENSMUST00000019422] [ENSMUST00000127664] [ENSMUST00000212409] [ENSMUST00000212773]
Predicted Effect probably benign
Transcript: ENSMUST00000000759
SMART Domains Protein: ENSMUSP00000000759
Gene: ENSMUSG00000000743

DomainStartEndE-ValueType
Pfam:Snf7 4 174 6.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000019422
AA Change: S388C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019422
Gene: ENSMUSG00000019278
AA Change: S388C

DomainStartEndE-ValueType
Pfam:Peptidase_M19 25 352 4.1e-122 PFAM
low complexity region 398 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167655
Predicted Effect probably benign
Transcript: ENSMUST00000212409
Predicted Effect probably benign
Transcript: ENSMUST00000212773
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kidney membrane enzyme involved in the metabolism of glutathione and other similar proteins by dipeptide hydrolysis. The encoded protein is known to regulate leukotriene activity by catalyzing the conversion of leukotriene D4 to leukotriene E4. This protein uses zinc as a cofactor and acts as a disulfide-linked homodimer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for disruption of this gene ar phenotypically normal although defects have been noted in the conversion of leukotriene D4 to leukotrience E4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Txnrd2 A G 16: 18,475,565 H436R probably damaging Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Dpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Dpep1 APN 8 123199615 splice site probably benign
IGL02354:Dpep1 APN 8 123200218 missense probably benign
IGL02361:Dpep1 APN 8 123200218 missense probably benign
IGL02527:Dpep1 APN 8 123198748 missense probably damaging 1.00
IGL02723:Dpep1 APN 8 123194149 missense possibly damaging 0.95
R0190:Dpep1 UTSW 8 123200708 missense probably benign 0.21
R1348:Dpep1 UTSW 8 123199160 missense probably benign 0.02
R1719:Dpep1 UTSW 8 123200747 missense possibly damaging 0.67
R2060:Dpep1 UTSW 8 123200391 missense probably damaging 0.99
R2081:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R2279:Dpep1 UTSW 8 123194144 missense probably benign 0.04
R3931:Dpep1 UTSW 8 123198779 missense possibly damaging 0.73
R4027:Dpep1 UTSW 8 123194153 missense probably benign 0.12
R4836:Dpep1 UTSW 8 123200367 missense probably damaging 1.00
R5007:Dpep1 UTSW 8 123199378 missense probably damaging 0.97
R5149:Dpep1 UTSW 8 123200438 missense probably benign 0.01
R5268:Dpep1 UTSW 8 123194089 missense probably benign 0.12
R5774:Dpep1 UTSW 8 123199982 missense probably damaging 1.00
R6041:Dpep1 UTSW 8 123200655 missense probably damaging 0.99
R6335:Dpep1 UTSW 8 123200652 missense probably damaging 1.00
R7705:Dpep1 UTSW 8 123200721 missense possibly damaging 0.94
X0005:Dpep1 UTSW 8 123200988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCTCAGGAGGAACTGGACAGAGAC -3'
(R):5'- CCTGCTGCTTATTCAGGAAAGGGTG -3'

Sequencing Primer
(F):5'- TCCCCCAAacacacacacac -3'
(R):5'- GTGGTTCTGCACGGACAAC -3'
Posted On2013-09-03