Incidental Mutation 'R8885:Kmt2c'
ID 677221
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, E330008K23Rik, HALR
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8885 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 25271798-25498783 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25315079 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 2011 (T2011K)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045291
AA Change: T2011K

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: T2011K

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173073
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,406 S977C possibly damaging Het
4921507P07Rik A T 6: 50,574,048 Y474N possibly damaging Het
Abca8a T A 11: 110,069,479 D646V probably damaging Het
Adss T A 1: 177,769,960 Y378F probably damaging Het
Akap6 C T 12: 53,141,536 A1911V probably benign Het
Alg2 T C 4: 47,474,159 Y43C probably benign Het
Alk A C 17: 71,895,763 V1159G probably damaging Het
Alx3 A T 3: 107,600,694 Q173L probably damaging Het
Aqp9 A G 9: 71,162,311 probably benign Het
Atf7ip C A 6: 136,587,143 L787I probably benign Het
Bbs9 A T 9: 22,678,938 E657D possibly damaging Het
Bean1 G A 8: 104,182,120 probably null Het
Cactin G T 10: 81,321,248 R13L unknown Het
Ccdc178 T C 18: 22,067,664 E412G probably damaging Het
Ccdc30 A G 4: 119,324,562 I583T probably damaging Het
Ccl8 T C 11: 82,116,107 Y49H probably damaging Het
Clptm1 T A 7: 19,639,007 K199N probably damaging Het
Cnbp G A 6: 87,845,664 S39L probably benign Het
Cnih3 T A 1: 181,409,872 probably benign Het
Cnksr3 A T 10: 7,140,201 probably benign Het
Cntn1 A G 15: 92,261,499 I512V probably benign Het
Col20a1 A G 2: 180,998,503 probably benign Het
Col28a1 A T 6: 8,127,360 probably benign Het
Col6a2 A T 10: 76,614,907 Y63* probably null Het
Copa T G 1: 172,097,745 F190V probably damaging Het
Crisp4 A C 1: 18,136,924 probably benign Het
Cxcl2 C T 5: 90,904,226 Q64* probably null Het
Cxcr5 T C 9: 44,514,252 D36G probably benign Het
Cyp20a1 T A 1: 60,372,606 V271E possibly damaging Het
D430041D05Rik T C 2: 104,241,193 Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 D57A probably benign Het
Ddx11 T A 17: 66,143,465 S492T probably benign Het
Dhx34 C T 7: 16,216,451 R264H probably damaging Het
Dnah3 T A 7: 119,962,152 I328F Het
Dnah5 C T 15: 28,327,740 R2087C probably damaging Het
Dnah8 C G 17: 30,708,312 S1314W possibly damaging Het
Dock2 T C 11: 34,310,396 N982D probably benign Het
Dync1h1 A G 12: 110,616,738 D423G probably damaging Het
Ect2l A C 10: 18,172,835 L213V probably damaging Het
Fam210a T C 18: 68,276,144 I32V probably benign Het
Fancg A G 4: 43,007,266 probably null Het
Fastkd5 T C 2: 130,615,191 E493G probably benign Het
Fbxo38 T C 18: 62,526,201 M342V probably damaging Het
Flnc A C 6: 29,455,411 K2020Q probably damaging Het
Flt4 A G 11: 49,636,333 probably benign Het
Frmd4b G T 6: 97,412,519 P129T probably benign Het
Galnt13 C A 2: 54,880,126 A310E probably benign Het
Gm4884 T A 7: 41,044,684 Y692* probably null Het
Gm6309 T A 5: 146,168,293 D270V probably damaging Het
Grip1 G T 10: 119,454,287 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kdf1 G T 4: 133,528,194 C74F probably damaging Het
Kdm1b T A 13: 47,053,708 C169* probably null Het
Lama1 G A 17: 67,773,784 G1269E Het
Lamb3 C T 1: 193,334,874 A791V probably benign Het
Leng9 G T 7: 4,148,775 R301S possibly damaging Het
Lgr6 C A 1: 134,987,604 V746L probably benign Het
Lrp5 T A 19: 3,652,170 S216C probably damaging Het
Ltn1 T C 16: 87,381,545 T1599A probably damaging Het
Map2k1 G T 9: 64,187,324 N345K probably damaging Het
Map4k1 T A 7: 28,989,437 D304E probably benign Het
Mcpt1 C T 14: 56,019,065 T86I probably damaging Het
Mcpt9 T C 14: 56,027,696 K116R probably benign Het
Morc2a G T 11: 3,678,584 A346S probably damaging Het
Mybpc3 A T 2: 91,123,892 Q370L probably benign Het
Nars2 T C 7: 97,002,888 S229P probably damaging Het
Ndufa10 A T 1: 92,469,971 Y118N probably damaging Het
Nek11 A T 9: 105,295,372 probably null Het
Notch4 T C 17: 34,584,496 V1463A possibly damaging Het
Nrcam T C 12: 44,564,125 I536T probably benign Het
Olfr771 T C 10: 129,160,465 Y173C probably benign Het
Pbld1 A T 10: 63,076,447 T285S probably benign Het
Pcdhgb8 A T 18: 37,763,124 T416S possibly damaging Het
Plekhg6 T C 6: 125,374,560 D242G probably damaging Het
Pnmt T A 11: 98,387,754 V182D probably benign Het
Ppp1r13b G T 12: 111,833,437 N758K probably damaging Het
Prex2 A G 1: 11,170,575 probably benign Het
Prss3 A T 6: 41,377,578 L7Q probably damaging Het
Prss43 T A 9: 110,830,978 L370Q probably damaging Het
Rac1 A T 5: 143,508,130 V104E probably damaging Het
Rgs9 T C 11: 109,275,623 Y107C probably damaging Het
Rnase13 C T 14: 51,922,483 W66* probably null Het
Rrp1b G A 17: 32,051,714 V216I possibly damaging Het
Serinc1 A G 10: 57,519,768 S309P probably benign Het
Serpine3 T A 14: 62,665,138 L66Q probably damaging Het
Smc5 C T 19: 23,213,870 V924M probably damaging Het
Srgap1 A T 10: 121,925,640 probably benign Het
Stab1 T C 14: 31,161,814 E262G possibly damaging Het
Ston2 A G 12: 91,639,724 *896R probably null Het
Syt6 A G 3: 103,625,625 M442V probably benign Het
Tap1 T C 17: 34,189,562 probably null Het
Tbx3 A C 5: 119,680,559 S420R probably benign Het
Tespa1 A T 10: 130,362,447 Q446L probably benign Het
Tifab T C 13: 56,176,295 M112V probably benign Het
Trpv5 A T 6: 41,653,258 S633T possibly damaging Het
Ttn T C 2: 76,853,892 K838R unknown Het
Ttn A T 2: 76,914,466 V5413E probably damaging Het
Tub C A 7: 109,029,586 N415K Het
Vmn2r3 T C 3: 64,274,962 M439V probably benign Het
Vps13c A G 9: 67,943,454 D2231G probably benign Het
Wbp1 C T 6: 83,119,932 C118Y unknown Het
Zdhhc20 C T 14: 57,890,214 probably benign Het
Zfp217 T A 2: 170,114,471 N869I probably benign Het
Zfp677 T C 17: 21,398,088 I469T probably benign Het
Zmym2 T A 14: 56,947,872 probably benign Het
Zzef1 T G 11: 72,796,576 S94A probably benign Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25315666 missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25315106 missense probably benign 0.21
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0671:Kmt2c UTSW 5 25404365 missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25285079 missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25352280 missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R4983:Kmt2c UTSW 5 25295511 missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25300362 missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25344925 missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25299491 missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25309807 missense probably benign 0.00
R7402:Kmt2c UTSW 5 25395420 missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25302849 missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25308532 missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25284564 missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25414970 missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25315095 missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25315719 missense probably benign 0.01
R7714:Kmt2c UTSW 5 25375366 missense probably benign
R7838:Kmt2c UTSW 5 25294699 missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25300111 missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25299816 missense probably benign 0.18
R7895:Kmt2c UTSW 5 25373176 missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25315196 missense probably benign 0.01
R7974:Kmt2c UTSW 5 25300563 missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25359678 missense probably benign 0.00
R8011:Kmt2c UTSW 5 25351234 missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25287119 missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25281680 missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25302732 missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25329252 missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25281384 missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25374564 missense probably benign 0.00
R8169:Kmt2c UTSW 5 25354687 missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25314539 missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25283106 missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25324218 missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25405516 missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25304694 missense probably null 1.00
R8355:Kmt2c UTSW 5 25354501 critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25354501 critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25314122 missense probably benign 0.34
R8907:Kmt2c UTSW 5 25309611 missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25298887 missense probably benign
R8969:Kmt2c UTSW 5 25314389 missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25283210 missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25319012 missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25284345 missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25284196 missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25311104 missense probably benign 0.01
R9171:Kmt2c UTSW 5 25281311 missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25299999 missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25292909 missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25349862 missense probably benign 0.34
R9336:Kmt2c UTSW 5 25409167 missense probably benign 0.06
R9443:Kmt2c UTSW 5 25310047 missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25292909 missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25349862 missense probably benign 0.34
R9526:Kmt2c UTSW 5 25281357 missense probably damaging 1.00
R9653:Kmt2c UTSW 5 25302821 missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25284760 missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25372958 missense probably benign 0.18
R9784:Kmt2c UTSW 5 25344961 missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25315775 small insertion probably benign
RF006:Kmt2c UTSW 5 25315772 small insertion probably benign
RF011:Kmt2c UTSW 5 25338459 missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25315775 small insertion probably benign
RF047:Kmt2c UTSW 5 25315760 small insertion probably benign
RF051:Kmt2c UTSW 5 25313479 unclassified probably benign
RF055:Kmt2c UTSW 5 25315772 small insertion probably benign
RF059:Kmt2c UTSW 5 25313479 unclassified probably benign
RF063:Kmt2c UTSW 5 25315764 small insertion probably benign
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25354413 missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25295397 critical splice donor site probably null
Z1177:Kmt2c UTSW 5 25300003 missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25366197 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATTATCTACTGGCCTTGGTGTC -3'
(R):5'- AGCCAGAGACTTATGTGCTTCC -3'

Sequencing Primer
(F):5'- TTGGTGTCAAGGCAGGCC -3'
(R):5'- GTGCTTCCTCCATGACAAACAGTG -3'
Posted On 2021-08-02