Incidental Mutation 'R8885:Gm6309'
ID 677225
Institutional Source Beutler Lab
Gene Symbol Gm6309
Ensembl Gene ENSMUSG00000096798
Gene Name predicted gene 6309
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8885 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 146167976-146170721 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146168293 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 270 (D270V)
Ref Sequence ENSEMBL: ENSMUSP00000134203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174320]
AlphaFold L7N481
Predicted Effect probably damaging
Transcript: ENSMUST00000174320
AA Change: D270V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134203
Gene: ENSMUSG00000096798
AA Change: D270V

DomainStartEndE-ValueType
RasGEFN 65 181 3.29e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,406 S977C possibly damaging Het
4921507P07Rik A T 6: 50,574,048 Y474N possibly damaging Het
Abca8a T A 11: 110,069,479 D646V probably damaging Het
Adss T A 1: 177,769,960 Y378F probably damaging Het
Akap6 C T 12: 53,141,536 A1911V probably benign Het
Alg2 T C 4: 47,474,159 Y43C probably benign Het
Alk A C 17: 71,895,763 V1159G probably damaging Het
Alx3 A T 3: 107,600,694 Q173L probably damaging Het
Aqp9 A G 9: 71,162,311 probably benign Het
Atf7ip C A 6: 136,587,143 L787I probably benign Het
Bbs9 A T 9: 22,678,938 E657D possibly damaging Het
Bean1 G A 8: 104,182,120 probably null Het
Cactin G T 10: 81,321,248 R13L unknown Het
Ccdc178 T C 18: 22,067,664 E412G probably damaging Het
Ccdc30 A G 4: 119,324,562 I583T probably damaging Het
Ccl8 T C 11: 82,116,107 Y49H probably damaging Het
Clptm1 T A 7: 19,639,007 K199N probably damaging Het
Cnbp G A 6: 87,845,664 S39L probably benign Het
Cnih3 T A 1: 181,409,872 probably benign Het
Cnksr3 A T 10: 7,140,201 probably benign Het
Cntn1 A G 15: 92,261,499 I512V probably benign Het
Col20a1 A G 2: 180,998,503 probably benign Het
Col28a1 A T 6: 8,127,360 probably benign Het
Col6a2 A T 10: 76,614,907 Y63* probably null Het
Copa T G 1: 172,097,745 F190V probably damaging Het
Crisp4 A C 1: 18,136,924 probably benign Het
Cxcl2 C T 5: 90,904,226 Q64* probably null Het
Cxcr5 T C 9: 44,514,252 D36G probably benign Het
Cyp20a1 T A 1: 60,372,606 V271E possibly damaging Het
D430041D05Rik T C 2: 104,241,193 Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 D57A probably benign Het
Ddx11 T A 17: 66,143,465 S492T probably benign Het
Dhx34 C T 7: 16,216,451 R264H probably damaging Het
Dnah3 T A 7: 119,962,152 I328F Het
Dnah5 C T 15: 28,327,740 R2087C probably damaging Het
Dnah8 C G 17: 30,708,312 S1314W possibly damaging Het
Dock2 T C 11: 34,310,396 N982D probably benign Het
Dync1h1 A G 12: 110,616,738 D423G probably damaging Het
Ect2l A C 10: 18,172,835 L213V probably damaging Het
Fam210a T C 18: 68,276,144 I32V probably benign Het
Fancg A G 4: 43,007,266 probably null Het
Fastkd5 T C 2: 130,615,191 E493G probably benign Het
Fbxo38 T C 18: 62,526,201 M342V probably damaging Het
Flnc A C 6: 29,455,411 K2020Q probably damaging Het
Flt4 A G 11: 49,636,333 probably benign Het
Frmd4b G T 6: 97,412,519 P129T probably benign Het
Galnt13 C A 2: 54,880,126 A310E probably benign Het
Gm4884 T A 7: 41,044,684 Y692* probably null Het
Grip1 G T 10: 119,454,287 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kdf1 G T 4: 133,528,194 C74F probably damaging Het
Kdm1b T A 13: 47,053,708 C169* probably null Het
Kmt2c G T 5: 25,315,079 T2011K probably benign Het
Lama1 G A 17: 67,773,784 G1269E Het
Lamb3 C T 1: 193,334,874 A791V probably benign Het
Leng9 G T 7: 4,148,775 R301S possibly damaging Het
Lgr6 C A 1: 134,987,604 V746L probably benign Het
Lrp5 T A 19: 3,652,170 S216C probably damaging Het
Ltn1 T C 16: 87,381,545 T1599A probably damaging Het
Map2k1 G T 9: 64,187,324 N345K probably damaging Het
Map4k1 T A 7: 28,989,437 D304E probably benign Het
Mcpt1 C T 14: 56,019,065 T86I probably damaging Het
Mcpt9 T C 14: 56,027,696 K116R probably benign Het
Morc2a G T 11: 3,678,584 A346S probably damaging Het
Mybpc3 A T 2: 91,123,892 Q370L probably benign Het
Nars2 T C 7: 97,002,888 S229P probably damaging Het
Ndufa10 A T 1: 92,469,971 Y118N probably damaging Het
Nek11 A T 9: 105,295,372 probably null Het
Notch4 T C 17: 34,584,496 V1463A possibly damaging Het
Nrcam T C 12: 44,564,125 I536T probably benign Het
Olfr771 T C 10: 129,160,465 Y173C probably benign Het
Pbld1 A T 10: 63,076,447 T285S probably benign Het
Pcdhgb8 A T 18: 37,763,124 T416S possibly damaging Het
Plekhg6 T C 6: 125,374,560 D242G probably damaging Het
Pnmt T A 11: 98,387,754 V182D probably benign Het
Ppp1r13b G T 12: 111,833,437 N758K probably damaging Het
Prex2 A G 1: 11,170,575 probably benign Het
Prss3 A T 6: 41,377,578 L7Q probably damaging Het
Prss43 T A 9: 110,830,978 L370Q probably damaging Het
Rac1 A T 5: 143,508,130 V104E probably damaging Het
Rgs9 T C 11: 109,275,623 Y107C probably damaging Het
Rnase13 C T 14: 51,922,483 W66* probably null Het
Rrp1b G A 17: 32,051,714 V216I possibly damaging Het
Serinc1 A G 10: 57,519,768 S309P probably benign Het
Serpine3 T A 14: 62,665,138 L66Q probably damaging Het
Smc5 C T 19: 23,213,870 V924M probably damaging Het
Srgap1 A T 10: 121,925,640 probably benign Het
Stab1 T C 14: 31,161,814 E262G possibly damaging Het
Ston2 A G 12: 91,639,724 *896R probably null Het
Syt6 A G 3: 103,625,625 M442V probably benign Het
Tap1 T C 17: 34,189,562 probably null Het
Tbx3 A C 5: 119,680,559 S420R probably benign Het
Tespa1 A T 10: 130,362,447 Q446L probably benign Het
Tifab T C 13: 56,176,295 M112V probably benign Het
Trpv5 A T 6: 41,653,258 S633T possibly damaging Het
Ttn T C 2: 76,853,892 K838R unknown Het
Ttn A T 2: 76,914,466 V5413E probably damaging Het
Tub C A 7: 109,029,586 N415K Het
Vmn2r3 T C 3: 64,274,962 M439V probably benign Het
Vps13c A G 9: 67,943,454 D2231G probably benign Het
Wbp1 C T 6: 83,119,932 C118Y unknown Het
Zdhhc20 C T 14: 57,890,214 probably benign Het
Zfp217 T A 2: 170,114,471 N869I probably benign Het
Zfp677 T C 17: 21,398,088 I469T probably benign Het
Zmym2 T A 14: 56,947,872 probably benign Het
Zzef1 T G 11: 72,796,576 S94A probably benign Het
Other mutations in Gm6309
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Gm6309 APN 5 146168411 missense probably benign 0.02
IGL01835:Gm6309 APN 5 146168275 missense probably damaging 0.99
FR4737:Gm6309 UTSW 5 146168183 missense probably benign
FR4976:Gm6309 UTSW 5 146168183 missense probably benign
R1513:Gm6309 UTSW 5 146170583 missense possibly damaging 0.83
R2022:Gm6309 UTSW 5 146168311 missense probably benign
R2191:Gm6309 UTSW 5 146168871 missense possibly damaging 0.93
R4735:Gm6309 UTSW 5 146168244 missense probably damaging 0.99
R5719:Gm6309 UTSW 5 146168182 missense probably benign 0.01
R5776:Gm6309 UTSW 5 146168881 missense possibly damaging 0.80
R5833:Gm6309 UTSW 5 146168318 missense probably damaging 1.00
R6246:Gm6309 UTSW 5 146170240 missense probably damaging 1.00
R6373:Gm6309 UTSW 5 146170275 missense probably damaging 0.97
R6873:Gm6309 UTSW 5 146168188 missense probably damaging 0.96
R6912:Gm6309 UTSW 5 146168830 missense probably damaging 0.97
R6954:Gm6309 UTSW 5 146168490 missense possibly damaging 0.82
R7145:Gm6309 UTSW 5 146170290 missense possibly damaging 0.74
R7258:Gm6309 UTSW 5 146168296 missense probably benign 0.07
R7535:Gm6309 UTSW 5 146168290 missense probably damaging 1.00
R8941:Gm6309 UTSW 5 146170345 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGTAGAACTCTGCAGACC -3'
(R):5'- GATTTTGCCACAGCTCCAGAG -3'

Sequencing Primer
(F):5'- GGGTAGAACTCTGCAGACCATTCTC -3'
(R):5'- TCAGAGCAGGATGCCTCTG -3'
Posted On 2021-08-02