Mutagenetix > Incidental Mutation

Incidental Mutation 'R8885:Dnah3'

677242

Institutional Source

Beutler Lab

Gene Symbol

Dnah3

Ensembl Gene

ENSMUSG00000052273

Gene Name

dynein, axonemal, heavy chain 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R8885 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119922671-120095280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119962152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 328 (I328F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046993
AA Change: I2715F

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: I2715F

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	805	820	N/A	INTRINSIC
Pfam:DHC_N2	826	1235	3.3e-144	PFAM
AAA	1388	1527	1.59e-1	SMART
low complexity region	1594	1606	N/A	INTRINSIC
Blast:AAA	1669	1897	9e-84	BLAST
AAA	2033	2180	1.33e-3	SMART
Pfam:AAA_8	2362	2632	1.5e-63	PFAM
Pfam:MT	2644	2994	7.4e-52	PFAM
Pfam:AAA_9	3015	3240	3.5e-92	PFAM
low complexity region	3338	3349	N/A	INTRINSIC
Pfam:Dynein_heavy	3376	4079	4.4e-285	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000209154
AA Change: I2704F

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably benign
Transcript: ENSMUST00000213149

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (104/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,323,406	S977C	possibly damaging	Het
4921507P07Rik	A	T	6: 50,574,048	Y474N	possibly damaging	Het
Abca8a	T	A	11: 110,069,479	D646V	probably damaging	Het
Adss	T	A	1: 177,769,960	Y378F	probably damaging	Het
Akap6	C	T	12: 53,141,536	A1911V	probably benign	Het
Alg2	T	C	4: 47,474,159	Y43C	probably benign	Het
Alk	A	C	17: 71,895,763	V1159G	probably damaging	Het
Alx3	A	T	3: 107,600,694	Q173L	probably damaging	Het
Aqp9	A	G	9: 71,162,311		probably benign	Het
Atf7ip	C	A	6: 136,587,143	L787I	probably benign	Het
Bbs9	A	T	9: 22,678,938	E657D	possibly damaging	Het
Bean1	G	A	8: 104,182,120		probably null	Het
Cactin	G	T	10: 81,321,248	R13L	unknown	Het
Ccdc178	T	C	18: 22,067,664	E412G	probably damaging	Het
Ccdc30	A	G	4: 119,324,562	I583T	probably damaging	Het
Ccl8	T	C	11: 82,116,107	Y49H	probably damaging	Het
Clptm1	T	A	7: 19,639,007	K199N	probably damaging	Het
Cnbp	G	A	6: 87,845,664	S39L	probably benign	Het
Cnih3	T	A	1: 181,409,872		probably benign	Het
Cnksr3	A	T	10: 7,140,201		probably benign	Het
Cntn1	A	G	15: 92,261,499	I512V	probably benign	Het
Col20a1	A	G	2: 180,998,503		probably benign	Het
Col28a1	A	T	6: 8,127,360		probably benign	Het
Col6a2	A	T	10: 76,614,907	Y63*	probably null	Het
Copa	T	G	1: 172,097,745	F190V	probably damaging	Het
Crisp4	A	C	1: 18,136,924		probably benign	Het
Cxcl2	C	T	5: 90,904,226	Q64*	probably null	Het
Cxcr5	T	C	9: 44,514,252	D36G	probably benign	Het
Cyp20a1	T	A	1: 60,372,606	V271E	possibly damaging	Het
D430041D05Rik	T	C	2: 104,241,193	Y570C	probably damaging	Het
Ddi1	T	G	9: 6,266,198	D57A	probably benign	Het
Ddx11	T	A	17: 66,143,465	S492T	probably benign	Het
Dhx34	C	T	7: 16,216,451	R264H	probably damaging	Het
Dnah5	C	T	15: 28,327,740	R2087C	probably damaging	Het
Dnah8	C	G	17: 30,708,312	S1314W	possibly damaging	Het
Dock2	T	C	11: 34,310,396	N982D	probably benign	Het
Dync1h1	A	G	12: 110,616,738	D423G	probably damaging	Het
Ect2l	A	C	10: 18,172,835	L213V	probably damaging	Het
Fam210a	T	C	18: 68,276,144	I32V	probably benign	Het
Fancg	A	G	4: 43,007,266		probably null	Het
Fastkd5	T	C	2: 130,615,191	E493G	probably benign	Het
Fbxo38	T	C	18: 62,526,201	M342V	probably damaging	Het
Flnc	A	C	6: 29,455,411	K2020Q	probably damaging	Het
Flt4	A	G	11: 49,636,333		probably benign	Het
Frmd4b	G	T	6: 97,412,519	P129T	probably benign	Het
Galnt13	C	A	2: 54,880,126	A310E	probably benign	Het
Gm4884	T	A	7: 41,044,684	Y692*	probably null	Het
Gm6309	T	A	5: 146,168,293	D270V	probably damaging	Het
Grip1	G	T	10: 119,454,287		probably benign	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kdf1	G	T	4: 133,528,194	C74F	probably damaging	Het
Kdm1b	T	A	13: 47,053,708	C169*	probably null	Het
Kmt2c	G	T	5: 25,315,079	T2011K	probably benign	Het
Lama1	G	A	17: 67,773,784	G1269E		Het
Lamb3	C	T	1: 193,334,874	A791V	probably benign	Het
Leng9	G	T	7: 4,148,775	R301S	possibly damaging	Het
Lgr6	C	A	1: 134,987,604	V746L	probably benign	Het
Lrp5	T	A	19: 3,652,170	S216C	probably damaging	Het
Ltn1	T	C	16: 87,381,545	T1599A	probably damaging	Het
Map2k1	G	T	9: 64,187,324	N345K	probably damaging	Het
Map4k1	T	A	7: 28,989,437	D304E	probably benign	Het
Mcpt1	C	T	14: 56,019,065	T86I	probably damaging	Het
Mcpt9	T	C	14: 56,027,696	K116R	probably benign	Het
Morc2a	G	T	11: 3,678,584	A346S	probably damaging	Het
Mybpc3	A	T	2: 91,123,892	Q370L	probably benign	Het
Nars2	T	C	7: 97,002,888	S229P	probably damaging	Het
Ndufa10	A	T	1: 92,469,971	Y118N	probably damaging	Het
Nek11	A	T	9: 105,295,372		probably null	Het
Notch4	T	C	17: 34,584,496	V1463A	possibly damaging	Het
Nrcam	T	C	12: 44,564,125	I536T	probably benign	Het
Olfr771	T	C	10: 129,160,465	Y173C	probably benign	Het
Pbld1	A	T	10: 63,076,447	T285S	probably benign	Het
Pcdhgb8	A	T	18: 37,763,124	T416S	possibly damaging	Het
Plekhg6	T	C	6: 125,374,560	D242G	probably damaging	Het
Pnmt	T	A	11: 98,387,754	V182D	probably benign	Het
Ppp1r13b	G	T	12: 111,833,437	N758K	probably damaging	Het
Prex2	A	G	1: 11,170,575		probably benign	Het
Prss3	A	T	6: 41,377,578	L7Q	probably damaging	Het
Prss43	T	A	9: 110,830,978	L370Q	probably damaging	Het
Rac1	A	T	5: 143,508,130	V104E	probably damaging	Het
Rgs9	T	C	11: 109,275,623	Y107C	probably damaging	Het
Rnase13	C	T	14: 51,922,483	W66*	probably null	Het
Rrp1b	G	A	17: 32,051,714	V216I	possibly damaging	Het
Serinc1	A	G	10: 57,519,768	S309P	probably benign	Het
Serpine3	T	A	14: 62,665,138	L66Q	probably damaging	Het
Smc5	C	T	19: 23,213,870	V924M	probably damaging	Het
Srgap1	A	T	10: 121,925,640		probably benign	Het
Stab1	T	C	14: 31,161,814	E262G	possibly damaging	Het
Ston2	A	G	12: 91,639,724	*896R	probably null	Het
Syt6	A	G	3: 103,625,625	M442V	probably benign	Het
Tap1	T	C	17: 34,189,562		probably null	Het
Tbx3	A	C	5: 119,680,559	S420R	probably benign	Het
Tespa1	A	T	10: 130,362,447	Q446L	probably benign	Het
Tifab	T	C	13: 56,176,295	M112V	probably benign	Het
Trpv5	A	T	6: 41,653,258	S633T	possibly damaging	Het
Ttn	T	C	2: 76,853,892	K838R	unknown	Het
Ttn	A	T	2: 76,914,466	V5413E	probably damaging	Het
Tub	C	A	7: 109,029,586	N415K		Het
Vmn2r3	T	C	3: 64,274,962	M439V	probably benign	Het
Vps13c	A	G	9: 67,943,454	D2231G	probably benign	Het
Wbp1	C	T	6: 83,119,932	C118Y	unknown	Het
Zdhhc20	C	T	14: 57,890,214		probably benign	Het
Zfp217	T	A	2: 170,114,471	N869I	probably benign	Het
Zfp677	T	C	17: 21,398,088	I469T	probably benign	Het
Zmym2	T	A	14: 56,947,872		probably benign	Het
Zzef1	T	G	11: 72,796,576	S94A	probably benign	Het

Other mutations in Dnah3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Dnah3	APN	7	119938905	missense	possibly damaging	0.88
IGL01095:Dnah3	APN	7	119951597	missense	probably benign	0.02
IGL01329:Dnah3	APN	7	120022941	missense	probably damaging	1.00
IGL01380:Dnah3	APN	7	119926564	missense	probably damaging	1.00
IGL01410:Dnah3	APN	7	119967720	missense	possibly damaging	0.91
IGL01487:Dnah3	APN	7	119965530	nonsense	probably null
IGL01843:Dnah3	APN	7	119943575	missense	probably benign	0.12
IGL01929:Dnah3	APN	7	119951651	nonsense	probably null
IGL01994:Dnah3	APN	7	119951214	missense	possibly damaging	0.58
IGL02115:Dnah3	APN	7	120029054	missense	probably damaging	1.00
IGL02273:Dnah3	APN	7	119951271	missense	probably damaging	1.00
IGL02299:Dnah3	APN	7	119967579	missense	probably benign	0.39
IGL02421:Dnah3	APN	7	119950992	missense	possibly damaging	0.87
IGL02514:Dnah3	APN	7	119966247	missense	probably damaging	1.00
IGL02596:Dnah3	APN	7	119938914	missense	probably benign	0.19
IGL02716:Dnah3	APN	7	119937023	missense	probably damaging	0.97
IGL02738:Dnah3	APN	7	119965497	missense	probably benign
IGL03404:Dnah3	APN	7	119938977	missense	probably damaging	1.00
R0964_Dnah3_480	UTSW	7	119952739	splice site	probably benign
R1778_Dnah3_238	UTSW	7	120078402	missense	probably damaging	1.00
R4658_Dnah3_599	UTSW	7	119950651	missense	probably damaging	1.00
BB004:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
BB014:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R0011:Dnah3	UTSW	7	120019701	missense	probably damaging	1.00
R0195:Dnah3	UTSW	7	120077775	critical splice donor site	probably null
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0312:Dnah3	UTSW	7	120045659	missense	probably damaging	1.00
R0316:Dnah3	UTSW	7	119965659	missense	possibly damaging	0.94
R0370:Dnah3	UTSW	7	120086720	missense	possibly damaging	0.91
R0426:Dnah3	UTSW	7	119943572	missense	probably benign	0.11
R0525:Dnah3	UTSW	7	119928754	missense	probably damaging	1.00
R0625:Dnah3	UTSW	7	120071887	missense	possibly damaging	0.68
R0627:Dnah3	UTSW	7	120020915	missense	probably damaging	1.00
R0632:Dnah3	UTSW	7	119967905	missense	probably benign	0.11
R0928:Dnah3	UTSW	7	120030051	missense	probably damaging	1.00
R0964:Dnah3	UTSW	7	119952739	splice site	probably benign
R0972:Dnah3	UTSW	7	120035340	splice site	probably null
R1066:Dnah3	UTSW	7	120061009	missense	probably damaging	1.00
R1082:Dnah3	UTSW	7	120078445	missense	probably damaging	1.00
R1127:Dnah3	UTSW	7	119923030	missense	probably damaging	1.00
R1132:Dnah3	UTSW	7	119939004	missense	possibly damaging	0.50
R1222:Dnah3	UTSW	7	120090676	missense	probably benign	0.28
R1420:Dnah3	UTSW	7	119951979	missense	probably damaging	0.99
R1456:Dnah3	UTSW	7	120047630	missense	probably damaging	1.00
R1472:Dnah3	UTSW	7	120070958	missense	probably benign	0.12
R1617:Dnah3	UTSW	7	120089946	missense	probably benign	0.01
R1624:Dnah3	UTSW	7	120019695	missense	probably damaging	0.99
R1654:Dnah3	UTSW	7	119926449	missense	probably damaging	1.00
R1673:Dnah3	UTSW	7	119971179	nonsense	probably null
R1677:Dnah3	UTSW	7	119928740	missense	probably damaging	1.00
R1687:Dnah3	UTSW	7	120045786	splice site	probably null
R1711:Dnah3	UTSW	7	120078571	missense	probably damaging	1.00
R1738:Dnah3	UTSW	7	120035359	missense	probably damaging	1.00
R1778:Dnah3	UTSW	7	120078402	missense	probably damaging	1.00
R1866:Dnah3	UTSW	7	119928856	splice site	probably null
R1883:Dnah3	UTSW	7	120077919	missense	probably benign	0.06
R1894:Dnah3	UTSW	7	120086334	missense	probably benign	0.05
R1929:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R1988:Dnah3	UTSW	7	119967570	missense	possibly damaging	0.92
R1988:Dnah3	UTSW	7	119967959	missense	probably damaging	0.99
R2010:Dnah3	UTSW	7	120095177	start codon destroyed	probably benign	0.00
R2022:Dnah3	UTSW	7	119951242	missense	probably damaging	1.00
R2026:Dnah3	UTSW	7	120039406	missense	probably damaging	1.00
R2063:Dnah3	UTSW	7	119951909	missense	probably damaging	0.96
R2131:Dnah3	UTSW	7	119967759	missense	possibly damaging	0.93
R2152:Dnah3	UTSW	7	119952013	missense	probably benign	0.02
R2199:Dnah3	UTSW	7	119951569	missense	possibly damaging	0.89
R2271:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R2350:Dnah3	UTSW	7	120045788	splice site	probably null
R2567:Dnah3	UTSW	7	119952697	missense	possibly damaging	0.83
R2848:Dnah3	UTSW	7	119967938	missense	probably benign	0.01
R2902:Dnah3	UTSW	7	119951499	missense	possibly damaging	0.61
R2926:Dnah3	UTSW	7	119951115	missense	probably damaging	1.00
R2944:Dnah3	UTSW	7	119951110	missense	probably damaging	1.00
R3022:Dnah3	UTSW	7	120078481	missense	possibly damaging	0.93
R3401:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3402:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3403:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3919:Dnah3	UTSW	7	119951080	missense	probably damaging	1.00
R3972:Dnah3	UTSW	7	120086720	missense	probably damaging	0.99
R4162:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4184:Dnah3	UTSW	7	120083293	missense	probably damaging	1.00
R4198:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4199:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4200:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4239:Dnah3	UTSW	7	120029025	nonsense	probably null
R4478:Dnah3	UTSW	7	120071863	missense	probably benign	0.00
R4579:Dnah3	UTSW	7	120009331	missense	probably damaging	1.00
R4600:Dnah3	UTSW	7	120089946	missense	probably benign
R4649:Dnah3	UTSW	7	120047698	missense	probably damaging	1.00
R4658:Dnah3	UTSW	7	119950651	missense	probably damaging	1.00
R4728:Dnah3	UTSW	7	120059366	missense	probably damaging	0.99
R4739:Dnah3	UTSW	7	120077946	missense	possibly damaging	0.54
R4758:Dnah3	UTSW	7	120079406	missense	probably benign	0.00
R4785:Dnah3	UTSW	7	119967824	missense	probably benign	0.29
R4789:Dnah3	UTSW	7	120011072	missense	probably damaging	1.00
R4930:Dnah3	UTSW	7	119951681	nonsense	probably null
R4935:Dnah3	UTSW	7	120016477	nonsense	probably null
R4946:Dnah3	UTSW	7	119931560	missense	probably damaging	1.00
R4981:Dnah3	UTSW	7	119956201	missense	probably benign	0.03
R4984:Dnah3	UTSW	7	119928779	missense	probably benign	0.04
R5025:Dnah3	UTSW	7	120071905	missense	probably benign	0.02
R5046:Dnah3	UTSW	7	119951580	missense	probably damaging	1.00
R5056:Dnah3	UTSW	7	120020946	missense	probably damaging	1.00
R5068:Dnah3	UTSW	7	120032790	missense	probably benign
R5069:Dnah3	UTSW	7	120032790	missense	probably benign
R5154:Dnah3	UTSW	7	119952419	missense	probably damaging	1.00
R5208:Dnah3	UTSW	7	120032638	missense	probably damaging	1.00
R5323:Dnah3	UTSW	7	120021011	missense	probably damaging	1.00
R5330:Dnah3	UTSW	7	119943648	missense	probably benign	0.00
R5385:Dnah3	UTSW	7	119924903	missense	probably damaging	1.00
R5391:Dnah3	UTSW	7	120090076	missense	probably benign	0.02
R5564:Dnah3	UTSW	7	119971466	critical splice donor site	probably null
R5594:Dnah3	UTSW	7	119971621	missense	possibly damaging	0.89
R5610:Dnah3	UTSW	7	119939065	splice site	probably null
R5673:Dnah3	UTSW	7	119951589	missense	possibly damaging	0.91
R5678:Dnah3	UTSW	7	120077851	missense	probably benign	0.00
R5737:Dnah3	UTSW	7	120059198	missense	probably benign	0.03
R5766:Dnah3	UTSW	7	119978222	missense	probably damaging	1.00
R5769:Dnah3	UTSW	7	120089952	nonsense	probably null
R5789:Dnah3	UTSW	7	119943599	missense	possibly damaging	0.70
R5791:Dnah3	UTSW	7	119931473	missense	probably benign	0.00
R5841:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5843:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5844:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5846:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5851:Dnah3	UTSW	7	120039362	missense	possibly damaging	0.51
R5853:Dnah3	UTSW	7	119938833	missense	probably damaging	1.00
R5857:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5865:Dnah3	UTSW	7	119975108	missense	probably benign	0.00
R5885:Dnah3	UTSW	7	120069704	missense	probably benign	0.10
R5898:Dnah3	UTSW	7	120078501	missense	probably benign	0.37
R5917:Dnah3	UTSW	7	120016526	missense	probably damaging	1.00
R5964:Dnah3	UTSW	7	119922880	missense	probably benign	0.00
R5990:Dnah3	UTSW	7	120073541	missense	probably benign
R6004:Dnah3	UTSW	7	120086297	missense	probably benign	0.10
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6045:Dnah3	UTSW	7	119967522	missense	probably damaging	0.99
R6056:Dnah3	UTSW	7	120030031	missense	probably damaging	1.00
R6133:Dnah3	UTSW	7	120086246	missense	probably benign	0.10
R6229:Dnah3	UTSW	7	119965488	missense	probably benign	0.11
R6237:Dnah3	UTSW	7	120009384	missense	probably damaging	1.00
R6333:Dnah3	UTSW	7	120054633	missense	probably damaging	1.00
R6408:Dnah3	UTSW	7	119922968	splice site	probably null
R6447:Dnah3	UTSW	7	119923054	missense	probably benign	0.12
R6606:Dnah3	UTSW	7	120060956	missense	probably benign	0.02
R6666:Dnah3	UTSW	7	120070949	missense	probably benign	0.16
R6733:Dnah3	UTSW	7	119922974	missense	probably benign	0.22
R6815:Dnah3	UTSW	7	119971727	missense	probably benign
R6882:Dnah3	UTSW	7	119971184	missense	possibly damaging	0.95
R6934:Dnah3	UTSW	7	120054601	critical splice donor site	probably null
R6966:Dnah3	UTSW	7	120032754	missense	probably damaging	1.00
R7025:Dnah3	UTSW	7	120030010	missense	possibly damaging	0.90
R7207:Dnah3	UTSW	7	119971089	missense	probably damaging	1.00
R7214:Dnah3	UTSW	7	119922742	missense	probably damaging	1.00
R7222:Dnah3	UTSW	7	120071523	missense	probably benign	0.00
R7235:Dnah3	UTSW	7	120032670	missense	probably damaging	1.00
R7241:Dnah3	UTSW	7	119943633	missense	probably benign	0.03
R7313:Dnah3	UTSW	7	119981344	missense	probably benign	0.39
R7342:Dnah3	UTSW	7	120029985	missense	probably damaging	1.00
R7368:Dnah3	UTSW	7	120029016	missense	probably benign
R7375:Dnah3	UTSW	7	119951677	missense	probably damaging	1.00
R7395:Dnah3	UTSW	7	119966251	missense
R7395:Dnah3	UTSW	7	120060960	missense	probably benign	0.00
R7431:Dnah3	UTSW	7	120051744	missense	probably damaging	1.00
R7499:Dnah3	UTSW	7	120060912	missense	probably damaging	0.99
R7515:Dnah3	UTSW	7	120073592	missense	probably benign	0.21
R7564:Dnah3	UTSW	7	119971594	missense	probably benign
R7618:Dnah3	UTSW	7	119978378	missense	probably damaging	0.97
R7697:Dnah3	UTSW	7	119967434	missense
R7728:Dnah3	UTSW	7	119938828	missense	probably damaging	1.00
R7757:Dnah3	UTSW	7	119971215	splice site	probably null
R7757:Dnah3	UTSW	7	120071570	missense	probably benign
R7774:Dnah3	UTSW	7	119951752	nonsense	probably null
R7804:Dnah3	UTSW	7	119952618	missense	probably damaging	1.00
R7804:Dnah3	UTSW	7	120011012	missense	probably damaging	1.00
R7857:Dnah3	UTSW	7	119951704	missense	probably damaging	1.00
R7871:Dnah3	UTSW	7	119967552	missense
R7903:Dnah3	UTSW	7	120042128	missense	probably damaging	1.00
R7927:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R7989:Dnah3	UTSW	7	120077789	missense	probably benign
R8142:Dnah3	UTSW	7	120060966	missense	probably benign	0.00
R8164:Dnah3	UTSW	7	119967614	missense	probably damaging	1.00
R8237:Dnah3	UTSW	7	119926413	missense	probably benign	0.01
R8313:Dnah3	UTSW	7	119951152	missense	probably benign	0.38
R8338:Dnah3	UTSW	7	120071881	missense	probably benign	0.01
R8355:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8408:Dnah3	UTSW	7	119952505	missense	probably damaging	1.00
R8411:Dnah3	UTSW	7	120011030	missense	probably damaging	1.00
R8455:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8483:Dnah3	UTSW	7	119937030	missense	probably benign	0.00
R8531:Dnah3	UTSW	7	119951368	missense	probably damaging	1.00
R8912:Dnah3	UTSW	7	120090646	missense	probably benign	0.06
R8966:Dnah3	UTSW	7	119950658	nonsense	probably null
R8982:Dnah3	UTSW	7	119937071	missense	probably damaging	1.00
R9043:Dnah3	UTSW	7	119952049	missense	probably benign
R9053:Dnah3	UTSW	7	120019764	missense	possibly damaging	0.67
R9059:Dnah3	UTSW	7	120085145	missense	probably benign	0.01
R9182:Dnah3	UTSW	7	120085128	missense	probably damaging	0.98
R9365:Dnah3	UTSW	7	119967636	missense
R9383:Dnah3	UTSW	7	120047596	missense	probably benign	0.23
R9430:Dnah3	UTSW	7	120028982	missense	probably damaging	1.00
R9449:Dnah3	UTSW	7	119952250	missense	probably benign	0.12
R9462:Dnah3	UTSW	7	119952300	missense	probably benign	0.05
R9505:Dnah3	UTSW	7	120045689	missense	probably damaging	1.00
R9559:Dnah3	UTSW	7	120051728	missense	probably benign	0.07
R9562:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9565:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9609:Dnah3	UTSW	7	120071013	missense	probably damaging	0.98
R9622:Dnah3	UTSW	7	119962133	missense
R9633:Dnah3	UTSW	7	119950993	missense	probably benign
R9654:Dnah3	UTSW	7	120042173	nonsense	probably null
R9665:Dnah3	UTSW	7	120045758	missense	probably benign	0.01
R9681:Dnah3	UTSW	7	120078388	missense	probably benign	0.04
R9717:Dnah3	UTSW	7	119975076	missense	probably damaging	1.00
Z1088:Dnah3	UTSW	7	120010873	missense	probably null	1.00
Z1088:Dnah3	UTSW	7	120086297	missense	probably benign	0.00
Z1176:Dnah3	UTSW	7	119967803	missense
Z1177:Dnah3	UTSW	7	119967901	missense	probably damaging	0.99
Z1177:Dnah3	UTSW	7	120007862	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCAGTTTTGACTCAGAGTGG -3'
(R):5'- GACAGTGCTGATCTCATGTCTCTC -3'

Sequencing Primer
(F):5'- CCCAGTTTTGACTCAGAGTGGGATAG -3'
(R):5'- CCCTCTTCCACGCTAGGTG -3'

Posted On

2021-08-02