Incidental Mutation 'R8885:Dock2'
ID677260
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8885 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34310396 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 982 (N982D)
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect probably benign
Transcript: ENSMUST00000093192
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
AA Change: N982D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: N982D

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101365
AA Change: N982D

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143
AA Change: N982D

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165963
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,406 S977C possibly damaging Het
4921507P07Rik A T 6: 50,574,048 Y474N possibly damaging Het
Abca8a T A 11: 110,069,479 D646V probably damaging Het
Adss T A 1: 177,769,960 Y378F probably damaging Het
Akap6 C T 12: 53,141,536 A1911V probably benign Het
Alg2 T C 4: 47,474,159 Y43C probably benign Het
Alk A C 17: 71,895,763 V1159G probably damaging Het
Alx3 A T 3: 107,600,694 Q173L probably damaging Het
Atf7ip C A 6: 136,587,143 L787I probably benign Het
Bbs9 A T 9: 22,678,938 E657D possibly damaging Het
Bean1 G A 8: 104,182,120 probably null Het
Cactin G T 10: 81,321,248 R13L unknown Het
Ccdc178 T C 18: 22,067,664 E412G probably damaging Het
Ccdc30 A G 4: 119,324,562 I583T probably damaging Het
Ccl8 T C 11: 82,116,107 Y49H probably damaging Het
Clptm1 T A 7: 19,639,007 K199N probably damaging Het
Cnbp G A 6: 87,845,664 S39L probably benign Het
Cntn1 A G 15: 92,261,499 I512V probably benign Het
Col6a2 A T 10: 76,614,907 Y63* probably null Het
Copa T G 1: 172,097,745 F190V probably damaging Het
Cxcl2 C T 5: 90,904,226 Q64* probably null Het
Cxcr5 T C 9: 44,514,252 D36G probably benign Het
Cyp20a1 T A 1: 60,372,606 V271E possibly damaging Het
D430041D05Rik T C 2: 104,241,193 Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 D57A probably benign Het
Ddx11 T A 17: 66,143,465 S492T probably benign Het
Dhx34 C T 7: 16,216,451 R264H probably damaging Het
Dnah3 T A 7: 119,962,152 I328F Het
Dnah5 C T 15: 28,327,740 R2087C probably damaging Het
Dnah8 C G 17: 30,708,312 S1314W possibly damaging Het
Dync1h1 A G 12: 110,616,738 D423G probably damaging Het
Ect2l A C 10: 18,172,835 L213V probably damaging Het
Fam210a T C 18: 68,276,144 I32V probably benign Het
Fancg A G 4: 43,007,266 probably null Het
Fastkd5 T C 2: 130,615,191 E493G probably benign Het
Fbxo38 T C 18: 62,526,201 M342V probably damaging Het
Flnc A C 6: 29,455,411 K2020Q probably damaging Het
Frmd4b G T 6: 97,412,519 P129T probably benign Het
Galnt13 C A 2: 54,880,126 A310E probably benign Het
Gm4884 T A 7: 41,044,684 Y692* probably null Het
Gm6309 T A 5: 146,168,293 D270V probably damaging Het
Grip1 G T 10: 119,454,287 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kdf1 G T 4: 133,528,194 C74F probably damaging Het
Kdm1b T A 13: 47,053,708 C169* probably null Het
Kmt2c G T 5: 25,315,079 T2011K probably benign Het
Lama1 G A 17: 67,773,784 G1269E Het
Lamb3 C T 1: 193,334,874 A791V probably benign Het
Leng9 G T 7: 4,148,775 R301S possibly damaging Het
Lgr6 C A 1: 134,987,604 V746L probably benign Het
Lrp5 T A 19: 3,652,170 S216C probably damaging Het
Ltn1 T C 16: 87,381,545 T1599A probably damaging Het
Map2k1 G T 9: 64,187,324 N345K probably damaging Het
Map4k1 T A 7: 28,989,437 D304E probably benign Het
Mcpt1 C T 14: 56,019,065 T86I probably damaging Het
Mcpt9 T C 14: 56,027,696 K116R probably benign Het
Morc2a G T 11: 3,678,584 A346S probably damaging Het
Mybpc3 A T 2: 91,123,892 Q370L probably benign Het
Nars2 T C 7: 97,002,888 S229P probably damaging Het
Ndufa10 A T 1: 92,469,971 Y118N probably damaging Het
Nek11 A T 9: 105,295,372 probably null Het
Notch4 T C 17: 34,584,496 V1463A possibly damaging Het
Nrcam T C 12: 44,564,125 I536T probably benign Het
Olfr771 T C 10: 129,160,465 Y173C probably benign Het
Pbld1 A T 10: 63,076,447 T285S probably benign Het
Pcdhgb8 A T 18: 37,763,124 T416S possibly damaging Het
Plekhg6 T C 6: 125,374,560 D242G probably damaging Het
Pnmt T A 11: 98,387,754 V182D probably benign Het
Ppp1r13b G T 12: 111,833,437 N758K probably damaging Het
Prss3 A T 6: 41,377,578 L7Q probably damaging Het
Prss43 T A 9: 110,830,978 L370Q probably damaging Het
Rac1 A T 5: 143,508,130 V104E probably damaging Het
Rgs9 T C 11: 109,275,623 Y107C probably damaging Het
Rnase13 C T 14: 51,922,483 W66* probably null Het
Rrp1b G A 17: 32,051,714 V216I possibly damaging Het
Serinc1 A G 10: 57,519,768 S309P probably benign Het
Serpine3 T A 14: 62,665,138 L66Q probably damaging Het
Smc5 C T 19: 23,213,870 V924M probably damaging Het
Stab1 T C 14: 31,161,814 E262G possibly damaging Het
Ston2 A G 12: 91,639,724 *896R probably null Het
Syt6 A G 3: 103,625,625 M442V probably benign Het
Tap1 T C 17: 34,189,562 probably null Het
Tbx3 A C 5: 119,680,559 S420R probably benign Het
Tespa1 A T 10: 130,362,447 Q446L probably benign Het
Tifab T C 13: 56,176,295 M112V probably benign Het
Trpv5 A T 6: 41,653,258 S633T possibly damaging Het
Ttn T C 2: 76,853,892 K838R unknown Het
Ttn A T 2: 76,914,466 V5413E probably damaging Het
Tub C A 7: 109,029,586 N415K Het
Vmn2r3 T C 3: 64,274,962 M439V probably benign Het
Vps13c A G 9: 67,943,454 D2231G probably benign Het
Wbp1 C T 6: 83,119,932 C118Y unknown Het
Zdhhc20 C T 14: 57,890,214 probably benign Het
Zfp217 T A 2: 170,114,471 N869I probably benign Het
Zfp677 T C 17: 21,398,088 I469T probably benign Het
Zzef1 T G 11: 72,796,576 S94A probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
Croesus UTSW 11 34721027 missense probably damaging 1.00
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
gildenstern UTSW 11 34732339 critical splice donor site probably null
godsgrace UTSW 11 34695453 missense probably damaging 1.00
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
narrowest UTSW 11 34282652 missense probably damaging 0.98
pier UTSW 11 34689766 missense probably damaging 1.00
Plank UTSW 11 34783795 missense possibly damaging 0.51
resplendent UTSW 11 34727460 nonsense probably null
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
toothskin UTSW 11 34464922 missense probably damaging 1.00
Touch UTSW 11 34273750 missense possibly damaging 0.95
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
BB009:Dock2 UTSW 11 34267998 missense probably benign 0.00
BB019:Dock2 UTSW 11 34267998 missense probably benign 0.00
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
R7397:Dock2 UTSW 11 34718989 missense probably benign 0.00
R7464:Dock2 UTSW 11 34695278 missense probably damaging 0.99
R7512:Dock2 UTSW 11 34312542 missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34720951 missense probably benign 0.43
R7663:Dock2 UTSW 11 34721027 missense probably damaging 1.00
R7779:Dock2 UTSW 11 34714455 missense probably benign 0.38
R7797:Dock2 UTSW 11 34282652 missense probably damaging 0.98
R7855:Dock2 UTSW 11 34273698 missense probably damaging 1.00
R7922:Dock2 UTSW 11 34707327 missense probably benign 0.29
R7932:Dock2 UTSW 11 34267998 missense probably benign 0.00
R8013:Dock2 UTSW 11 34705850 missense probably damaging 0.96
R8192:Dock2 UTSW 11 34732339 critical splice donor site probably null
R8244:Dock2 UTSW 11 34695453 missense probably damaging 1.00
R8307:Dock2 UTSW 11 34310362 missense possibly damaging 0.95
R8418:Dock2 UTSW 11 34718968 missense probably benign 0.01
R8460:Dock2 UTSW 11 34230825 critical splice acceptor site probably null
R8495:Dock2 UTSW 11 34231622 missense probably benign 0.14
R8556:Dock2 UTSW 11 34262457 missense possibly damaging 0.84
R8690:Dock2 UTSW 11 34727460 nonsense probably null
R8743:Dock2 UTSW 11 34273252 nonsense probably null
R8757:Dock2 UTSW 11 34695240 missense probably benign 0.13
R8759:Dock2 UTSW 11 34695240 missense probably benign 0.13
R8793:Dock2 UTSW 11 34501215 missense probably benign 0.00
R8882:Dock2 UTSW 11 34704609 frame shift probably null
R8943:Dock2 UTSW 11 34708819 missense possibly damaging 0.63
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Z1176:Dock2 UTSW 11 34718924 missense probably benign 0.04
Z1177:Dock2 UTSW 11 34312553 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGTGTTTGTGCACAGAAAGG -3'
(R):5'- TGAGGCAGAATCTTAGTAGCGG -3'

Sequencing Primer
(F):5'- TTTGTGCACAGAAAGGAAGGGC -3'
(R):5'- CCATTTCTAACTGGTTGTGATGAC -3'
Posted On2021-08-02