Incidental Mutation 'R8885:Zzef1'
ID 677261
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Name zinc finger, ZZ-type with EF hand domain 1
Synonyms C130099L13Rik, 8430405D05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8885 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72796226-72927120 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72796576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 94 (S94A)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000079681] [ENSMUST00000156294] [ENSMUST00000172220] [ENSMUST00000207107]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069395
AA Change: S94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: S94A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079681
SMART Domains Protein: ENSMUSP00000078623
Gene: ENSMUSG00000057778

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Cyt-b5 38 134 5.75e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156294
Predicted Effect probably benign
Transcript: ENSMUST00000172220
AA Change: S94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: S94A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207107
AA Change: S94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,406 S977C possibly damaging Het
4921507P07Rik A T 6: 50,574,048 Y474N possibly damaging Het
Abca8a T A 11: 110,069,479 D646V probably damaging Het
Adss T A 1: 177,769,960 Y378F probably damaging Het
Akap6 C T 12: 53,141,536 A1911V probably benign Het
Alg2 T C 4: 47,474,159 Y43C probably benign Het
Alk A C 17: 71,895,763 V1159G probably damaging Het
Alx3 A T 3: 107,600,694 Q173L probably damaging Het
Aqp9 A G 9: 71,162,311 probably benign Het
Atf7ip C A 6: 136,587,143 L787I probably benign Het
Bbs9 A T 9: 22,678,938 E657D possibly damaging Het
Bean1 G A 8: 104,182,120 probably null Het
Cactin G T 10: 81,321,248 R13L unknown Het
Ccdc178 T C 18: 22,067,664 E412G probably damaging Het
Ccdc30 A G 4: 119,324,562 I583T probably damaging Het
Ccl8 T C 11: 82,116,107 Y49H probably damaging Het
Clptm1 T A 7: 19,639,007 K199N probably damaging Het
Cnbp G A 6: 87,845,664 S39L probably benign Het
Cnih3 T A 1: 181,409,872 probably benign Het
Cnksr3 A T 10: 7,140,201 probably benign Het
Cntn1 A G 15: 92,261,499 I512V probably benign Het
Col20a1 A G 2: 180,998,503 probably benign Het
Col28a1 A T 6: 8,127,360 probably benign Het
Col6a2 A T 10: 76,614,907 Y63* probably null Het
Copa T G 1: 172,097,745 F190V probably damaging Het
Crisp4 A C 1: 18,136,924 probably benign Het
Cxcl2 C T 5: 90,904,226 Q64* probably null Het
Cxcr5 T C 9: 44,514,252 D36G probably benign Het
Cyp20a1 T A 1: 60,372,606 V271E possibly damaging Het
D430041D05Rik T C 2: 104,241,193 Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 D57A probably benign Het
Ddx11 T A 17: 66,143,465 S492T probably benign Het
Dhx34 C T 7: 16,216,451 R264H probably damaging Het
Dnah3 T A 7: 119,962,152 I328F Het
Dnah5 C T 15: 28,327,740 R2087C probably damaging Het
Dnah8 C G 17: 30,708,312 S1314W possibly damaging Het
Dock2 T C 11: 34,310,396 N982D probably benign Het
Dync1h1 A G 12: 110,616,738 D423G probably damaging Het
Ect2l A C 10: 18,172,835 L213V probably damaging Het
Fam210a T C 18: 68,276,144 I32V probably benign Het
Fancg A G 4: 43,007,266 probably null Het
Fastkd5 T C 2: 130,615,191 E493G probably benign Het
Fbxo38 T C 18: 62,526,201 M342V probably damaging Het
Flnc A C 6: 29,455,411 K2020Q probably damaging Het
Flt4 A G 11: 49,636,333 probably benign Het
Frmd4b G T 6: 97,412,519 P129T probably benign Het
Galnt13 C A 2: 54,880,126 A310E probably benign Het
Gm4884 T A 7: 41,044,684 Y692* probably null Het
Gm6309 T A 5: 146,168,293 D270V probably damaging Het
Grip1 G T 10: 119,454,287 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kdf1 G T 4: 133,528,194 C74F probably damaging Het
Kdm1b T A 13: 47,053,708 C169* probably null Het
Kmt2c G T 5: 25,315,079 T2011K probably benign Het
Lama1 G A 17: 67,773,784 G1269E Het
Lamb3 C T 1: 193,334,874 A791V probably benign Het
Leng9 G T 7: 4,148,775 R301S possibly damaging Het
Lgr6 C A 1: 134,987,604 V746L probably benign Het
Lrp5 T A 19: 3,652,170 S216C probably damaging Het
Ltn1 T C 16: 87,381,545 T1599A probably damaging Het
Map2k1 G T 9: 64,187,324 N345K probably damaging Het
Map4k1 T A 7: 28,989,437 D304E probably benign Het
Mcpt1 C T 14: 56,019,065 T86I probably damaging Het
Mcpt9 T C 14: 56,027,696 K116R probably benign Het
Morc2a G T 11: 3,678,584 A346S probably damaging Het
Mybpc3 A T 2: 91,123,892 Q370L probably benign Het
Nars2 T C 7: 97,002,888 S229P probably damaging Het
Ndufa10 A T 1: 92,469,971 Y118N probably damaging Het
Nek11 A T 9: 105,295,372 probably null Het
Notch4 T C 17: 34,584,496 V1463A possibly damaging Het
Nrcam T C 12: 44,564,125 I536T probably benign Het
Olfr771 T C 10: 129,160,465 Y173C probably benign Het
Pbld1 A T 10: 63,076,447 T285S probably benign Het
Pcdhgb8 A T 18: 37,763,124 T416S possibly damaging Het
Plekhg6 T C 6: 125,374,560 D242G probably damaging Het
Pnmt T A 11: 98,387,754 V182D probably benign Het
Ppp1r13b G T 12: 111,833,437 N758K probably damaging Het
Prex2 A G 1: 11,170,575 probably benign Het
Prss3 A T 6: 41,377,578 L7Q probably damaging Het
Prss43 T A 9: 110,830,978 L370Q probably damaging Het
Rac1 A T 5: 143,508,130 V104E probably damaging Het
Rgs9 T C 11: 109,275,623 Y107C probably damaging Het
Rnase13 C T 14: 51,922,483 W66* probably null Het
Rrp1b G A 17: 32,051,714 V216I possibly damaging Het
Serinc1 A G 10: 57,519,768 S309P probably benign Het
Serpine3 T A 14: 62,665,138 L66Q probably damaging Het
Smc5 C T 19: 23,213,870 V924M probably damaging Het
Srgap1 A T 10: 121,925,640 probably benign Het
Stab1 T C 14: 31,161,814 E262G possibly damaging Het
Ston2 A G 12: 91,639,724 *896R probably null Het
Syt6 A G 3: 103,625,625 M442V probably benign Het
Tap1 T C 17: 34,189,562 probably null Het
Tbx3 A C 5: 119,680,559 S420R probably benign Het
Tespa1 A T 10: 130,362,447 Q446L probably benign Het
Tifab T C 13: 56,176,295 M112V probably benign Het
Trpv5 A T 6: 41,653,258 S633T possibly damaging Het
Ttn T C 2: 76,853,892 K838R unknown Het
Ttn A T 2: 76,914,466 V5413E probably damaging Het
Tub C A 7: 109,029,586 N415K Het
Vmn2r3 T C 3: 64,274,962 M439V probably benign Het
Vps13c A G 9: 67,943,454 D2231G probably benign Het
Wbp1 C T 6: 83,119,932 C118Y unknown Het
Zdhhc20 C T 14: 57,890,214 probably benign Het
Zfp217 T A 2: 170,114,471 N869I probably benign Het
Zfp677 T C 17: 21,398,088 I469T probably benign Het
Zmym2 T A 14: 56,947,872 probably benign Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0136:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
R8874:Zzef1 UTSW 11 72863989 missense probably benign 0.00
R8972:Zzef1 UTSW 11 72900673 missense probably damaging 1.00
R8979:Zzef1 UTSW 11 72875177 missense probably benign 0.00
R9053:Zzef1 UTSW 11 72922476 missense probably benign
R9108:Zzef1 UTSW 11 72899778 missense probably benign 0.11
R9121:Zzef1 UTSW 11 72866120 nonsense probably null
R9370:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R9408:Zzef1 UTSW 11 72864827 missense possibly damaging 0.86
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Z1186:Zzef1 UTSW 11 72889182 missense probably benign
Z1187:Zzef1 UTSW 11 72889182 missense probably benign
Z1188:Zzef1 UTSW 11 72889182 missense probably benign
Z1189:Zzef1 UTSW 11 72889182 missense probably benign
Z1190:Zzef1 UTSW 11 72889182 missense probably benign
Z1191:Zzef1 UTSW 11 72889182 missense probably benign
Z1192:Zzef1 UTSW 11 72889182 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATCAAGATTGGGCTGCC -3'
(R):5'- AAGAACCCGAGGACCCTATG -3'

Sequencing Primer
(F):5'- ATCAAGATTGGGCTGCCGACTC -3'
(R):5'- AGGACCCTATGGCTTCCTG -3'
Posted On 2021-08-02