Incidental Mutation 'R8885:Dync1h1'
ID 677269
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
MMRRC Submission 068751-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8885 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110583172 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 423 (D423G)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: D423G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: D423G

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,471,525 (GRCm39) S977C possibly damaging Het
Abca8a T A 11: 109,960,305 (GRCm39) D646V probably damaging Het
Adss2 T A 1: 177,597,526 (GRCm39) Y378F probably damaging Het
Akap6 C T 12: 53,188,319 (GRCm39) A1911V probably benign Het
Alg2 T C 4: 47,474,159 (GRCm39) Y43C probably benign Het
Alk A C 17: 72,202,758 (GRCm39) V1159G probably damaging Het
Alx3 A T 3: 107,508,010 (GRCm39) Q173L probably damaging Het
Aqp9 A G 9: 71,069,593 (GRCm39) probably benign Het
Atf7ip C A 6: 136,564,141 (GRCm39) L787I probably benign Het
Bbs9 A T 9: 22,590,234 (GRCm39) E657D possibly damaging Het
Bean1 G A 8: 104,908,752 (GRCm39) probably null Het
Cactin G T 10: 81,157,082 (GRCm39) R13L unknown Het
Ccdc178 T C 18: 22,200,721 (GRCm39) E412G probably damaging Het
Ccdc30 A G 4: 119,181,759 (GRCm39) I583T probably damaging Het
Ccl8 T C 11: 82,006,933 (GRCm39) Y49H probably damaging Het
Clptm1 T A 7: 19,372,932 (GRCm39) K199N probably damaging Het
Cnbp G A 6: 87,822,646 (GRCm39) S39L probably benign Het
Cnih3 T A 1: 181,237,437 (GRCm39) probably benign Het
Cnksr3 A T 10: 7,090,201 (GRCm39) probably benign Het
Cntn1 A G 15: 92,159,380 (GRCm39) I512V probably benign Het
Col20a1 A G 2: 180,640,296 (GRCm39) probably benign Het
Col28a1 A T 6: 8,127,360 (GRCm39) probably benign Het
Col6a2 A T 10: 76,450,741 (GRCm39) Y63* probably null Het
Copa T G 1: 171,925,312 (GRCm39) F190V probably damaging Het
Crisp4 A C 1: 18,207,148 (GRCm39) probably benign Het
Cxcl2 C T 5: 91,052,085 (GRCm39) Q64* probably null Het
Cxcr5 T C 9: 44,425,549 (GRCm39) D36G probably benign Het
Cyp20a1 T A 1: 60,411,765 (GRCm39) V271E possibly damaging Het
D430041D05Rik T C 2: 104,071,538 (GRCm39) Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 (GRCm39) D57A probably benign Het
Ddx11 T A 17: 66,450,460 (GRCm39) S492T probably benign Het
Dhx34 C T 7: 15,950,376 (GRCm39) R264H probably damaging Het
Dnah3 T A 7: 119,561,375 (GRCm39) I328F Het
Dnah5 C T 15: 28,327,886 (GRCm39) R2087C probably damaging Het
Dnah8 C G 17: 30,927,286 (GRCm39) S1314W possibly damaging Het
Dock2 T C 11: 34,260,396 (GRCm39) N982D probably benign Het
Ect2l A C 10: 18,048,583 (GRCm39) L213V probably damaging Het
Fam210a T C 18: 68,409,215 (GRCm39) I32V probably benign Het
Fancg A G 4: 43,007,266 (GRCm39) probably null Het
Fastkd5 T C 2: 130,457,111 (GRCm39) E493G probably benign Het
Fbxo38 T C 18: 62,659,272 (GRCm39) M342V probably damaging Het
Flnc A C 6: 29,455,410 (GRCm39) K2020Q probably damaging Het
Flt4 A G 11: 49,527,160 (GRCm39) probably benign Het
Frmd4b G T 6: 97,389,480 (GRCm39) P129T probably benign Het
Galnt13 C A 2: 54,770,138 (GRCm39) A310E probably benign Het
Gm4884 T A 7: 40,694,108 (GRCm39) Y692* probably null Het
Gm6309 T A 5: 146,105,103 (GRCm39) D270V probably damaging Het
Grip1 G T 10: 119,290,192 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kdf1 G T 4: 133,255,505 (GRCm39) C74F probably damaging Het
Kdm1b T A 13: 47,207,184 (GRCm39) C169* probably null Het
Kmt2c G T 5: 25,520,077 (GRCm39) T2011K probably benign Het
Lama1 G A 17: 68,080,779 (GRCm39) G1269E Het
Lamb3 C T 1: 193,017,182 (GRCm39) A791V probably benign Het
Leng9 G T 7: 4,151,774 (GRCm39) R301S possibly damaging Het
Lgr6 C A 1: 134,915,342 (GRCm39) V746L probably benign Het
Lrp5 T A 19: 3,702,170 (GRCm39) S216C probably damaging Het
Ltn1 T C 16: 87,178,433 (GRCm39) T1599A probably damaging Het
Map2k1 G T 9: 64,094,606 (GRCm39) N345K probably damaging Het
Map4k1 T A 7: 28,688,862 (GRCm39) D304E probably benign Het
Mcpt1 C T 14: 56,256,522 (GRCm39) T86I probably damaging Het
Mcpt9 T C 14: 56,265,153 (GRCm39) K116R probably benign Het
Morc2a G T 11: 3,628,584 (GRCm39) A346S probably damaging Het
Mybpc3 A T 2: 90,954,237 (GRCm39) Q370L probably benign Het
Nars2 T C 7: 96,652,095 (GRCm39) S229P probably damaging Het
Ndufa10 A T 1: 92,397,693 (GRCm39) Y118N probably damaging Het
Nek11 A T 9: 105,172,571 (GRCm39) probably null Het
Notch4 T C 17: 34,803,470 (GRCm39) V1463A possibly damaging Het
Nrcam T C 12: 44,610,908 (GRCm39) I536T probably benign Het
Or6c202 T C 10: 128,996,334 (GRCm39) Y173C probably benign Het
Pbld1 A T 10: 62,912,226 (GRCm39) T285S probably benign Het
Pcdhgb8 A T 18: 37,896,177 (GRCm39) T416S possibly damaging Het
Plekhg6 T C 6: 125,351,523 (GRCm39) D242G probably damaging Het
Pnmt T A 11: 98,278,580 (GRCm39) V182D probably benign Het
Ppp1r13b G T 12: 111,799,871 (GRCm39) N758K probably damaging Het
Prex2 A G 1: 11,240,799 (GRCm39) probably benign Het
Prss3 A T 6: 41,354,512 (GRCm39) L7Q probably damaging Het
Prss43 T A 9: 110,660,046 (GRCm39) L370Q probably damaging Het
Rac1 A T 5: 143,493,885 (GRCm39) V104E probably damaging Het
Rgs9 T C 11: 109,166,449 (GRCm39) Y107C probably damaging Het
Rnase13 C T 14: 52,159,940 (GRCm39) W66* probably null Het
Rrp1b G A 17: 32,270,688 (GRCm39) V216I possibly damaging Het
Serinc1 A G 10: 57,395,864 (GRCm39) S309P probably benign Het
Serpine3 T A 14: 62,902,587 (GRCm39) L66Q probably damaging Het
Smc5 C T 19: 23,191,234 (GRCm39) V924M probably damaging Het
Spmip4 A T 6: 50,551,028 (GRCm39) Y474N possibly damaging Het
Srgap1 A T 10: 121,761,545 (GRCm39) probably benign Het
Stab1 T C 14: 30,883,771 (GRCm39) E262G possibly damaging Het
Ston2 A G 12: 91,606,498 (GRCm39) *896R probably null Het
Syt6 A G 3: 103,532,941 (GRCm39) M442V probably benign Het
Tap1 T C 17: 34,408,536 (GRCm39) probably null Het
Tbx3 A C 5: 119,818,624 (GRCm39) S420R probably benign Het
Tespa1 A T 10: 130,198,316 (GRCm39) Q446L probably benign Het
Tifab T C 13: 56,324,108 (GRCm39) M112V probably benign Het
Trpv5 A T 6: 41,630,192 (GRCm39) S633T possibly damaging Het
Ttn T C 2: 76,684,236 (GRCm39) K838R unknown Het
Ttn A T 2: 76,744,810 (GRCm39) V5413E probably damaging Het
Tub C A 7: 108,628,793 (GRCm39) N415K Het
Vmn2r3 T C 3: 64,182,383 (GRCm39) M439V probably benign Het
Vps13c A G 9: 67,850,736 (GRCm39) D2231G probably benign Het
Wbp1 C T 6: 83,096,913 (GRCm39) C118Y unknown Het
Zdhhc20 C T 14: 58,127,671 (GRCm39) probably benign Het
Zfp217 T A 2: 169,956,391 (GRCm39) N869I probably benign Het
Zfp677 T C 17: 21,618,350 (GRCm39) I469T probably benign Het
Zmym2 T A 14: 57,185,329 (GRCm39) probably benign Het
Zzef1 T G 11: 72,687,402 (GRCm39) S94A probably benign Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110,583,241 (GRCm39) missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110,629,063 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110,592,166 (GRCm39) missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2113:Dync1h1 UTSW 12 110,596,420 (GRCm39) missense probably damaging 1.00
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110,584,483 (GRCm39) nonsense probably null
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGAAGTACCCGATTCAGC -3'
(R):5'- TGACAATGACAGCCCTCAGC -3'

Sequencing Primer
(F):5'- AGAGACCTGAGTTCTCAGCTG -3'
(R):5'- GCCCTCAGCTGCTCGTG -3'
Posted On 2021-08-02