Incidental Mutation 'R8885:Zdhhc20'
ID 677278
Institutional Source Beutler Lab
Gene Symbol Zdhhc20
Ensembl Gene ENSMUSG00000021969
Gene Name zinc finger, DHHC domain containing 20
Synonyms B230110O18Rik, ENSMUSG00000055956, 5033406L14Rik, 4930542A17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R8885 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57832703-57890276 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) C to T at 57890214 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089473] [ENSMUST00000226057]
AlphaFold Q5Y5T1
Predicted Effect probably benign
Transcript: ENSMUST00000089473
SMART Domains Protein: ENSMUSP00000086900
Gene: ENSMUSG00000021969

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:zf-DHHC 121 250 2.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226057
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,323,406 S977C possibly damaging Het
4921507P07Rik A T 6: 50,574,048 Y474N possibly damaging Het
Abca8a T A 11: 110,069,479 D646V probably damaging Het
Adss T A 1: 177,769,960 Y378F probably damaging Het
Akap6 C T 12: 53,141,536 A1911V probably benign Het
Alg2 T C 4: 47,474,159 Y43C probably benign Het
Alk A C 17: 71,895,763 V1159G probably damaging Het
Alx3 A T 3: 107,600,694 Q173L probably damaging Het
Aqp9 A G 9: 71,162,311 probably benign Het
Atf7ip C A 6: 136,587,143 L787I probably benign Het
Bbs9 A T 9: 22,678,938 E657D possibly damaging Het
Bean1 G A 8: 104,182,120 probably null Het
Cactin G T 10: 81,321,248 R13L unknown Het
Ccdc178 T C 18: 22,067,664 E412G probably damaging Het
Ccdc30 A G 4: 119,324,562 I583T probably damaging Het
Ccl8 T C 11: 82,116,107 Y49H probably damaging Het
Clptm1 T A 7: 19,639,007 K199N probably damaging Het
Cnbp G A 6: 87,845,664 S39L probably benign Het
Cnih3 T A 1: 181,409,872 probably benign Het
Cnksr3 A T 10: 7,140,201 probably benign Het
Cntn1 A G 15: 92,261,499 I512V probably benign Het
Col20a1 A G 2: 180,998,503 probably benign Het
Col28a1 A T 6: 8,127,360 probably benign Het
Col6a2 A T 10: 76,614,907 Y63* probably null Het
Copa T G 1: 172,097,745 F190V probably damaging Het
Crisp4 A C 1: 18,136,924 probably benign Het
Cxcl2 C T 5: 90,904,226 Q64* probably null Het
Cxcr5 T C 9: 44,514,252 D36G probably benign Het
Cyp20a1 T A 1: 60,372,606 V271E possibly damaging Het
D430041D05Rik T C 2: 104,241,193 Y570C probably damaging Het
Ddi1 T G 9: 6,266,198 D57A probably benign Het
Ddx11 T A 17: 66,143,465 S492T probably benign Het
Dhx34 C T 7: 16,216,451 R264H probably damaging Het
Dnah3 T A 7: 119,962,152 I328F Het
Dnah5 C T 15: 28,327,740 R2087C probably damaging Het
Dnah8 C G 17: 30,708,312 S1314W possibly damaging Het
Dock2 T C 11: 34,310,396 N982D probably benign Het
Dync1h1 A G 12: 110,616,738 D423G probably damaging Het
Ect2l A C 10: 18,172,835 L213V probably damaging Het
Fam210a T C 18: 68,276,144 I32V probably benign Het
Fancg A G 4: 43,007,266 probably null Het
Fastkd5 T C 2: 130,615,191 E493G probably benign Het
Fbxo38 T C 18: 62,526,201 M342V probably damaging Het
Flnc A C 6: 29,455,411 K2020Q probably damaging Het
Flt4 A G 11: 49,636,333 probably benign Het
Frmd4b G T 6: 97,412,519 P129T probably benign Het
Galnt13 C A 2: 54,880,126 A310E probably benign Het
Gm4884 T A 7: 41,044,684 Y692* probably null Het
Gm6309 T A 5: 146,168,293 D270V probably damaging Het
Grip1 G T 10: 119,454,287 probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kdf1 G T 4: 133,528,194 C74F probably damaging Het
Kdm1b T A 13: 47,053,708 C169* probably null Het
Kmt2c G T 5: 25,315,079 T2011K probably benign Het
Lama1 G A 17: 67,773,784 G1269E Het
Lamb3 C T 1: 193,334,874 A791V probably benign Het
Leng9 G T 7: 4,148,775 R301S possibly damaging Het
Lgr6 C A 1: 134,987,604 V746L probably benign Het
Lrp5 T A 19: 3,652,170 S216C probably damaging Het
Ltn1 T C 16: 87,381,545 T1599A probably damaging Het
Map2k1 G T 9: 64,187,324 N345K probably damaging Het
Map4k1 T A 7: 28,989,437 D304E probably benign Het
Mcpt1 C T 14: 56,019,065 T86I probably damaging Het
Mcpt9 T C 14: 56,027,696 K116R probably benign Het
Morc2a G T 11: 3,678,584 A346S probably damaging Het
Mybpc3 A T 2: 91,123,892 Q370L probably benign Het
Nars2 T C 7: 97,002,888 S229P probably damaging Het
Ndufa10 A T 1: 92,469,971 Y118N probably damaging Het
Nek11 A T 9: 105,295,372 probably null Het
Notch4 T C 17: 34,584,496 V1463A possibly damaging Het
Nrcam T C 12: 44,564,125 I536T probably benign Het
Olfr771 T C 10: 129,160,465 Y173C probably benign Het
Pbld1 A T 10: 63,076,447 T285S probably benign Het
Pcdhgb8 A T 18: 37,763,124 T416S possibly damaging Het
Plekhg6 T C 6: 125,374,560 D242G probably damaging Het
Pnmt T A 11: 98,387,754 V182D probably benign Het
Ppp1r13b G T 12: 111,833,437 N758K probably damaging Het
Prex2 A G 1: 11,170,575 probably benign Het
Prss3 A T 6: 41,377,578 L7Q probably damaging Het
Prss43 T A 9: 110,830,978 L370Q probably damaging Het
Rac1 A T 5: 143,508,130 V104E probably damaging Het
Rgs9 T C 11: 109,275,623 Y107C probably damaging Het
Rnase13 C T 14: 51,922,483 W66* probably null Het
Rrp1b G A 17: 32,051,714 V216I possibly damaging Het
Serinc1 A G 10: 57,519,768 S309P probably benign Het
Serpine3 T A 14: 62,665,138 L66Q probably damaging Het
Smc5 C T 19: 23,213,870 V924M probably damaging Het
Srgap1 A T 10: 121,925,640 probably benign Het
Stab1 T C 14: 31,161,814 E262G possibly damaging Het
Ston2 A G 12: 91,639,724 *896R probably null Het
Syt6 A G 3: 103,625,625 M442V probably benign Het
Tap1 T C 17: 34,189,562 probably null Het
Tbx3 A C 5: 119,680,559 S420R probably benign Het
Tespa1 A T 10: 130,362,447 Q446L probably benign Het
Tifab T C 13: 56,176,295 M112V probably benign Het
Trpv5 A T 6: 41,653,258 S633T possibly damaging Het
Ttn T C 2: 76,853,892 K838R unknown Het
Ttn A T 2: 76,914,466 V5413E probably damaging Het
Tub C A 7: 109,029,586 N415K Het
Vmn2r3 T C 3: 64,274,962 M439V probably benign Het
Vps13c A G 9: 67,943,454 D2231G probably benign Het
Wbp1 C T 6: 83,119,932 C118Y unknown Het
Zfp217 T A 2: 170,114,471 N869I probably benign Het
Zfp677 T C 17: 21,398,088 I469T probably benign Het
Zmym2 T A 14: 56,947,872 probably benign Het
Zzef1 T G 11: 72,796,576 S94A probably benign Het
Other mutations in Zdhhc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zdhhc20 APN 14 57873924 missense probably damaging 0.99
IGL00983:Zdhhc20 APN 14 57839156 missense possibly damaging 0.62
IGL01107:Zdhhc20 APN 14 57865589 missense probably damaging 1.00
IGL01350:Zdhhc20 APN 14 57873987 missense probably benign 0.03
IGL02572:Zdhhc20 APN 14 57890107 missense probably benign 0.20
IGL02748:Zdhhc20 APN 14 57858553 missense probably benign 0.08
IGL03406:Zdhhc20 APN 14 57839099 missense probably benign
R0314:Zdhhc20 UTSW 14 57856619 missense probably damaging 1.00
R0631:Zdhhc20 UTSW 14 57857640 missense probably damaging 0.99
R1144:Zdhhc20 UTSW 14 57856678 missense probably benign 0.07
R1703:Zdhhc20 UTSW 14 57839088 critical splice donor site probably null
R1815:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R1816:Zdhhc20 UTSW 14 57890143 missense probably benign 0.10
R6219:Zdhhc20 UTSW 14 57840883 missense probably damaging 0.99
R6488:Zdhhc20 UTSW 14 57840832 missense probably benign 0.00
R6650:Zdhhc20 UTSW 14 57858575 missense probably damaging 1.00
R6790:Zdhhc20 UTSW 14 57890143 missense probably benign 0.00
R7196:Zdhhc20 UTSW 14 57873891 critical splice donor site probably null
R7365:Zdhhc20 UTSW 14 57873920 missense possibly damaging 0.95
R8126:Zdhhc20 UTSW 14 57846945 missense probably damaging 1.00
R8832:Zdhhc20 UTSW 14 57843264 missense possibly damaging 0.86
R8832:Zdhhc20 UTSW 14 57865632 missense probably benign 0.05
Z1176:Zdhhc20 UTSW 14 57839105 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACCCTCGGACGTGGAAC -3'
(R):5'- CTAGATGGCCTCCTACACATC -3'

Sequencing Primer
(F):5'- GAATCAGAACGCGGCGC -3'
(R):5'- AGATGGCCTCCTACACATCCTTAG -3'
Posted On 2021-08-02