Incidental Mutation 'T0975:Txnrd2'
ID67734
Institutional Source Beutler Lab
Gene Symbol Txnrd2
Ensembl Gene ENSMUSG00000075704
Gene Namethioredoxin reductase 2
SynonymsTR beta, TR3, TGR, ESTM573010
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #T0975 (G3) of strain 714
Quality Score195
Status Not validated
Chromosome16
Chromosomal Location18426384-18479073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18475565 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 436 (H436R)
Ref Sequence ENSEMBL: ENSMUSP00000146143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115605] [ENSMUST00000115606] [ENSMUST00000177856] [ENSMUST00000178093] [ENSMUST00000205679] [ENSMUST00000206151] [ENSMUST00000206606]
Predicted Effect probably damaging
Transcript: ENSMUST00000115605
AA Change: H448R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111268
Gene: ENSMUSG00000075704
AA Change: H448R

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 8.4e-7 PFAM
Pfam:GIDA 41 208 1.8e-4 PFAM
Pfam:Pyr_redox_2 41 365 1.2e-39 PFAM
Pfam:Pyr_redox_3 43 253 8.2e-7 PFAM
Pfam:Pyr_redox 220 302 5.7e-13 PFAM
Pfam:Pyr_redox_dim 388 477 3.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115606
AA Change: H467R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111269
Gene: ENSMUSG00000075704
AA Change: H467R

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:Pyr_redox_2 40 375 2.4e-71 PFAM
Pfam:FAD_binding_2 41 90 2.9e-8 PFAM
Pfam:Pyr_redox 220 299 2.1e-15 PFAM
Pfam:Pyr_redox_dim 395 508 7.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156604
Predicted Effect probably damaging
Transcript: ENSMUST00000177856
AA Change: H464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136402
Gene: ENSMUSG00000075704
AA Change: H464R

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 1.3e-8 PFAM
Pfam:GIDA 41 240 6.2e-7 PFAM
Pfam:Pyr_redox_2 41 365 3.9e-38 PFAM
Pfam:Pyr_redox 226 302 1.3e-10 PFAM
Pfam:Pyr_redox_dim 395 508 1.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178093
AA Change: H433R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136373
Gene: ENSMUSG00000075704
AA Change: H433R

DomainStartEndE-ValueType
low complexity region 8 36 N/A INTRINSIC
Pfam:FAD_binding_2 41 95 9e-7 PFAM
Pfam:GIDA 41 201 1.9e-4 PFAM
Pfam:Pyr_redox_2 41 365 2.3e-36 PFAM
Pfam:Pyr_redox 226 302 1.2e-8 PFAM
Pfam:Pyr_redox_dim 388 477 3.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205679
AA Change: H445R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206151
AA Change: H467R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206606
AA Change: H436R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product belongs to the family of pyridine nucleotide-disulfide oxidoreductases. It is a mitochondrial enzyme that catalyzes the reduction of thioredoxin, and is implicated in the defense against oxidative stress. This protein contains a selenocysteine (Sec) residue at its active site. The selenocysteine is encoded by the UGA codon, which normally signals translation termination. The 3' UTR of Sec-containing genes have a common stem-loop structure, the sec insertion sequence (SECIS), which is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die at E13 due to severe anemia and growth retardation, resulting from perturbed cardiac development and augmented apoptosis of hematopoietic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik TAA TAAA 11: 3,937,945 probably null Het
4930556J24Rik C T 11: 3,976,324 A27T unknown Het
Ago3 C T 4: 126,404,263 V155I probably benign Het
Ago3 C T 4: 126,404,305 A141T probably benign Het
Ago3 G A 4: 126,404,310 A139V probably benign Het
Ahdc1 ACCTCCT ACCTCCTCCT 4: 133,062,754 probably benign Het
Azin2 A G 4: 128,946,134 Y222H probably benign Het
Bpifb5 C A 2: 154,229,464 probably null Het
Ccdc157 C T 11: 4,146,246 A455T probably damaging Het
Ccng1 A C 11: 40,754,044 S9A probably benign Het
Cfh T C 1: 140,154,598 T164A probably benign Het
Cherp TTGGACCTGGACCTGGACCTGGACCTGGA TTGGACCTGGACCTGGACCTGGA 8: 72,462,034 probably benign Het
Chrng T C 1: 87,210,626 S380P probably benign Het
Clspn ACGGCGGCGGCGGCG ACGGCGGCGGCGGCGGCGGCG 4: 126,566,437 probably benign Het
Ctrc T TA 4: 141,845,196 probably null Het
Cxxc1 C T 18: 74,220,921 R593C probably damaging Het
Dlgap1 T C 17: 70,516,955 S312P possibly damaging Het
Dnah10 A G 5: 124,763,066 S1255G probably benign Het
Dpep1 A T 8: 123,200,988 S388C probably damaging Het
Emid1 A C 11: 5,128,884 L353V probably benign Het
Emid1 T C 11: 5,144,386 T42A probably damaging Het
Epn3 A G 11: 94,491,907 probably null Het
Fam124b T C 1: 80,213,126 E180G probably benign Het
Fam135b T G 15: 71,463,885 T487P probably damaging Het
Gatsl3 G C 11: 4,220,445 G147A probably benign Het
Gja4 G C 4: 127,312,231 H246Q probably benign Het
Gm7534 GTG GTGCTG 4: 134,202,629 probably benign Het
Gm9972 GA GAA 11: 43,036,770 probably null Het
Hmmr G C 11: 40,723,416 N148K probably damaging Het
Homez C T 14: 54,857,339 R304K possibly damaging Het
Ifngr1 G A 10: 19,609,473 V407M probably damaging Het
Inpp5j G T 11: 3,502,527 T241N possibly damaging Het
Kif12 GGGGC GGGGCCTCCACCCGGCGGGC 4: 63,171,423 probably benign Het
Kremen1 C T 11: 5,195,105 A424T probably benign Het
Mat2b G A 11: 40,680,091 T302I probably benign Het
Mtmr3 C T 11: 4,488,441 R671K probably benign Het
Nacad GCAGGGTCAGGGTC GCAGGGTCAGGGTCAGGGTC 11: 6,599,750 probably benign Het
Nacad T C 11: 6,601,622 N523S probably benign Het
Nacad A G 11: 6,601,632 C520R probably benign Het
Nefh G A 11: 4,940,151 P823S probably benign Het
Nfrkb G C 9: 31,397,083 A230P probably benign Het
Nlrp4a A G 7: 26,449,637 E223G probably damaging Het
Notch3 T A 17: 32,146,417 Y1107F probably damaging Het
Olfr1331 G T 4: 118,869,303 R174M probably benign Het
Olfr309 A T 7: 86,306,284 Y276* probably null Het
Olfr781 A G 10: 129,333,445 D188G probably benign Het
Osm A G 11: 4,239,588 D124G probably benign Het
Plekhm2 TTCCTCCTCCT TTCCTCCT 4: 141,631,981 probably benign Het
Pomgnt1 C T 4: 116,137,427 probably benign Het
Spen A G 4: 141,474,353 V2321A probably benign Het
Sytl1 TCTGC TC 4: 133,256,994 probably benign Het
Tcn2 G C 11: 3,923,487 F286L possibly damaging Het
Tg T C 15: 66,688,863 S10P probably benign Het
Tmprss7 C T 16: 45,680,733 R235Q probably benign Het
Tns3 G T 11: 8,451,146 L1051M probably benign Het
Tns3 T G 11: 8,479,518 E806A probably benign Het
Tns3 G A 11: 8,549,100 probably benign Het
Toe1 T C 4: 116,806,093 I62M probably benign Het
Ubr4 C T 4: 139,451,781 P2001S probably damaging Het
Vmn2r23 T A 6: 123,713,161 M332K probably benign Het
Zbtb8a GG GGATG 4: 129,360,019 probably benign Het
Zbtb8a T C 4: 129,360,212 H163R probably benign Het
Zfyve21 A G 12: 111,827,633 D206G probably damaging Het
Zkscan4 AGAGGAG AGAG 13: 21,479,200 probably benign Het
Zmym1 C T 4: 127,047,947 D785N probably benign Het
Zmym1 C T 4: 127,048,250 V684I probably benign Het
Zmym1 A C 4: 127,049,673 H307Q probably benign Het
Other mutations in Txnrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Txnrd2 APN 16 18438351 missense probably damaging 1.00
IGL00337:Txnrd2 APN 16 18477769 missense probably damaging 1.00
IGL01988:Txnrd2 APN 16 18456018 splice site probably benign
IGL02708:Txnrd2 APN 16 18468840 missense probably benign 0.38
IGL02949:Txnrd2 APN 16 18477706 missense probably benign 0.00
IGL03292:Txnrd2 APN 16 18477729 missense possibly damaging 0.53
R0610:Txnrd2 UTSW 16 18472882 missense probably damaging 0.96
R0723:Txnrd2 UTSW 16 18440879 splice site probably benign
R1625:Txnrd2 UTSW 16 18438366 missense probably damaging 1.00
R3000:Txnrd2 UTSW 16 18454513 missense probably damaging 1.00
R4180:Txnrd2 UTSW 16 18426425 splice site probably null
R4569:Txnrd2 UTSW 16 18456206 missense probably benign
R4570:Txnrd2 UTSW 16 18468804 missense probably benign 0.02
R4773:Txnrd2 UTSW 16 18440819 missense probably benign 0.15
R5385:Txnrd2 UTSW 16 18477692 missense probably damaging 1.00
R6074:Txnrd2 UTSW 16 18437547 missense probably damaging 1.00
R7247:Txnrd2 UTSW 16 18456072 missense probably damaging 0.99
R7630:Txnrd2 UTSW 16 18438390 missense possibly damaging 0.69
R8343:Txnrd2 UTSW 16 18426541 missense unknown
R8383:Txnrd2 UTSW 16 18472864 missense possibly damaging 0.83
R8428:Txnrd2 UTSW 16 18456298 missense unknown
R8852:Txnrd2 UTSW 16 18440851 missense possibly damaging 0.54
T0970:Txnrd2 UTSW 16 18441773 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGGGGCTGCCTACAGTTACAATG -3'
(R):5'- GCAGGGTCACTGTCCAGACAATTC -3'

Sequencing Primer
(F):5'- ccaccacaatcaaggtaatgtag -3'
(R):5'- ACTGTCCAGACAATTCAGTTGC -3'
Posted On2013-09-03