Incidental Mutation 'R8886:Dnah9'
ID 677343
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
MMRRC Submission 068691-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.400) question?
Stock # R8886 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 65722150-66059379 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65943840 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1932 (V1932E)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: V1932E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: V1932E

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik T A 1: 151,882,349 (GRCm39) N14I possibly damaging Het
1700066M21Rik T A 1: 57,422,008 (GRCm39) I128N probably damaging Het
4930407I10Rik G T 15: 81,950,051 (GRCm39) S1316I probably damaging Het
Abcc9 T C 6: 142,546,420 (GRCm39) probably benign Het
Adgrb3 A G 1: 25,150,928 (GRCm39) S1102P probably damaging Het
BC061237 A C 14: 44,741,691 (GRCm39) I145L probably benign Het
Birc7 A T 2: 180,574,786 (GRCm39) probably benign Het
Boc C T 16: 44,319,806 (GRCm39) G393S Het
Ccdc112 C T 18: 46,444,826 (GRCm39) G18R unknown Het
Cryzl1 T A 16: 91,492,188 (GRCm39) T213S possibly damaging Het
Cttnbp2 T C 6: 18,414,298 (GRCm39) N916D probably benign Het
Cyp4v3 A T 8: 45,774,785 (GRCm39) L123* probably null Het
Dmpk C A 7: 18,825,886 (GRCm39) probably benign Het
Ect2 T C 3: 27,200,126 (GRCm39) probably benign Het
Eif4a3 A G 11: 119,179,705 (GRCm39) Y361H probably damaging Het
Fkbp10 A G 11: 100,312,862 (GRCm39) E336G probably damaging Het
Gnptg T C 17: 25,453,628 (GRCm39) S305G probably benign Het
Greb1l A T 18: 10,553,843 (GRCm39) I1615F probably benign Het
Gse1 G A 8: 121,297,470 (GRCm39) R561Q unknown Het
Igkv9-129 T A 6: 67,817,221 (GRCm39) Y108* probably null Het
Igsf10 T A 3: 59,237,410 (GRCm39) T924S probably benign Het
Itgb6 A T 2: 60,458,324 (GRCm39) C476* probably null Het
Itih4 C T 14: 30,617,482 (GRCm39) Q601* probably null Het
Itpk1 G A 12: 102,550,604 (GRCm39) probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Jakmip3 G A 7: 138,609,171 (GRCm39) E92K probably benign Het
Klhl29 A T 12: 5,187,542 (GRCm39) L274H possibly damaging Het
Klk1b5 T A 7: 43,869,192 (GRCm39) M122K probably damaging Het
Krt84 A G 15: 101,437,221 (GRCm39) I314T possibly damaging Het
Lama2 A T 10: 27,245,157 (GRCm39) probably benign Het
Lmntd1 T C 6: 145,363,152 (GRCm39) T270A probably damaging Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Myh11 A G 16: 14,052,278 (GRCm39) I396T Het
Naprt T C 15: 75,765,433 (GRCm39) T136A probably damaging Het
Nbea T C 3: 55,966,148 (GRCm39) N438S probably damaging Het
Nckap1 C A 2: 80,339,055 (GRCm39) probably null Het
Nop56 G T 2: 130,117,902 (GRCm39) R126L probably damaging Het
Nts C T 10: 102,320,868 (GRCm39) A74T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or8b49 T G 9: 38,506,446 (GRCm39) F310V possibly damaging Het
Pcp2 A G 8: 3,675,208 (GRCm39) probably null Het
Pdgfra T C 5: 75,343,734 (GRCm39) S752P probably benign Het
Pign C T 1: 105,512,779 (GRCm39) V635I probably benign Het
Plekhg3 C A 12: 76,611,748 (GRCm39) H342Q possibly damaging Het
Ppp4c A T 7: 126,386,466 (GRCm39) I177N probably damaging Het
Psmd5 A G 2: 34,747,755 (GRCm39) F301L possibly damaging Het
Rad52 C T 6: 119,890,041 (GRCm39) R56C probably damaging Het
Rbm20 A T 19: 53,801,767 (GRCm39) I92L probably benign Het
Rnf213 A G 11: 119,364,264 (GRCm39) D4522G Het
Robo3 T C 9: 37,328,768 (GRCm39) E1276G probably damaging Het
Rxrb T C 17: 34,256,428 (GRCm39) F500L probably damaging Het
Sar1a A T 10: 61,522,172 (GRCm39) N88I possibly damaging Het
Scd3 A G 19: 44,230,276 (GRCm39) D353G probably damaging Het
Sh2d4b T C 14: 40,595,946 (GRCm39) probably benign Het
Ski A T 4: 155,244,016 (GRCm39) L498Q probably null Het
Spocd1 T A 4: 129,845,631 (GRCm39) M497K Het
Sspo A G 6: 48,458,201 (GRCm39) E3299G possibly damaging Het
St14 C A 9: 31,008,420 (GRCm39) V507F possibly damaging Het
Tcf24 G A 1: 10,037,388 (GRCm39) T108I probably benign Het
Tecta T C 9: 42,278,359 (GRCm39) T1050A probably benign Het
Ttc17 T C 2: 94,205,473 (GRCm39) D291G probably benign Het
Tubgcp2 G T 7: 139,584,882 (GRCm39) R518S probably benign Het
Ugt2a3 T C 5: 87,484,358 (GRCm39) Y222C probably damaging Het
Unc5c C G 3: 141,509,581 (GRCm39) A687G probably benign Het
Usp42 T C 5: 143,700,714 (GRCm39) D1103G probably damaging Het
Vmn1r83 A C 7: 12,055,843 (GRCm39) D71E probably benign Het
Vmn2r3 T A 3: 64,194,892 (GRCm39) I9F possibly damaging Het
Zfand1 T C 3: 10,409,862 (GRCm39) Q160R probably null Het
Zhx3 T C 2: 160,623,216 (GRCm39) N317S probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65,732,064 (GRCm39) splice site probably benign
IGL00805:Dnah9 APN 11 65,772,521 (GRCm39) missense probably benign 0.00
IGL00826:Dnah9 APN 11 65,880,768 (GRCm39) missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65,740,806 (GRCm39) missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 65,962,882 (GRCm39) missense probably damaging 1.00
IGL01353:Dnah9 APN 11 65,971,397 (GRCm39) missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66,046,285 (GRCm39) missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65,846,543 (GRCm39) missense probably benign 0.14
IGL01537:Dnah9 APN 11 65,838,506 (GRCm39) missense probably benign
IGL01565:Dnah9 APN 11 65,924,655 (GRCm39) missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66,009,656 (GRCm39) missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65,722,441 (GRCm39) nonsense probably null
IGL01625:Dnah9 APN 11 65,935,471 (GRCm39) missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66,009,655 (GRCm39) missense probably damaging 1.00
IGL01819:Dnah9 APN 11 65,998,952 (GRCm39) missense probably benign 0.33
IGL01896:Dnah9 APN 11 66,021,492 (GRCm39) missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 65,965,860 (GRCm39) splice site probably benign
IGL01923:Dnah9 APN 11 66,016,061 (GRCm39) splice site probably benign
IGL02059:Dnah9 APN 11 65,963,784 (GRCm39) missense probably damaging 1.00
IGL02068:Dnah9 APN 11 65,951,871 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66,008,318 (GRCm39) missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65,818,526 (GRCm39) missense probably damaging 1.00
IGL02264:Dnah9 APN 11 65,971,314 (GRCm39) splice site probably benign
IGL02325:Dnah9 APN 11 65,725,043 (GRCm39) missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66,015,979 (GRCm39) missense probably benign
IGL02440:Dnah9 APN 11 65,846,072 (GRCm39) missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65,838,444 (GRCm39) nonsense probably null
IGL02496:Dnah9 APN 11 65,920,189 (GRCm39) missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65,818,427 (GRCm39) missense probably benign 0.02
IGL02718:Dnah9 APN 11 65,777,466 (GRCm39) missense probably damaging 0.99
IGL02832:Dnah9 APN 11 65,931,172 (GRCm39) missense probably damaging 1.00
IGL02851:Dnah9 APN 11 65,928,570 (GRCm39) splice site probably benign
IGL02859:Dnah9 APN 11 65,772,445 (GRCm39) splice site probably benign
IGL02864:Dnah9 APN 11 65,951,829 (GRCm39) missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66,009,793 (GRCm39) missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65,732,099 (GRCm39) missense probably benign 0.23
IGL02987:Dnah9 APN 11 65,746,098 (GRCm39) missense probably damaging 0.98
IGL03160:Dnah9 APN 11 65,998,880 (GRCm39) missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65,872,067 (GRCm39) missense probably benign 0.13
IGL03180:Dnah9 APN 11 65,777,465 (GRCm39) missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65,838,368 (GRCm39) missense probably damaging 1.00
anarchy UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
sacco UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
Tweed UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
vanzetti UTSW 11 65,746,198 (GRCm39) nonsense probably null
IGL02837:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 65,895,839 (GRCm39) missense probably benign 0.44
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0021:Dnah9 UTSW 11 65,860,805 (GRCm39) missense probably benign 0.36
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0025:Dnah9 UTSW 11 65,860,781 (GRCm39) splice site probably benign
R0070:Dnah9 UTSW 11 66,050,866 (GRCm39) missense probably benign 0.10
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0164:Dnah9 UTSW 11 65,809,630 (GRCm39) nonsense probably null
R0180:Dnah9 UTSW 11 66,038,116 (GRCm39) missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R0230:Dnah9 UTSW 11 65,746,141 (GRCm39) missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65,802,678 (GRCm39) missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65,802,615 (GRCm39) critical splice donor site probably null
R0288:Dnah9 UTSW 11 65,915,960 (GRCm39) critical splice donor site probably null
R0309:Dnah9 UTSW 11 65,917,798 (GRCm39) splice site probably benign
R0356:Dnah9 UTSW 11 66,021,388 (GRCm39) critical splice donor site probably null
R0403:Dnah9 UTSW 11 65,975,615 (GRCm39) missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 65,998,961 (GRCm39) missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65,809,539 (GRCm39) splice site probably benign
R0496:Dnah9 UTSW 11 65,965,961 (GRCm39) missense probably null 1.00
R0557:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65,881,315 (GRCm39) missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66,009,703 (GRCm39) missense probably benign 0.02
R0599:Dnah9 UTSW 11 65,856,515 (GRCm39) missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65,732,159 (GRCm39) missense probably damaging 1.00
R0666:Dnah9 UTSW 11 65,976,284 (GRCm39) missense probably benign 0.01
R0715:Dnah9 UTSW 11 65,972,074 (GRCm39) splice site probably benign
R0726:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R0737:Dnah9 UTSW 11 65,998,724 (GRCm39) missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66,046,356 (GRCm39) missense probably benign 0.30
R0792:Dnah9 UTSW 11 65,786,827 (GRCm39) missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 65,896,002 (GRCm39) missense probably benign 0.00
R0973:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R0974:Dnah9 UTSW 11 65,896,663 (GRCm39) splice site probably null
R1055:Dnah9 UTSW 11 66,050,837 (GRCm39) missense probably damaging 1.00
R1081:Dnah9 UTSW 11 65,975,703 (GRCm39) missense probably damaging 0.99
R1184:Dnah9 UTSW 11 65,975,438 (GRCm39) critical splice donor site probably null
R1225:Dnah9 UTSW 11 65,761,886 (GRCm39) missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65,818,414 (GRCm39) missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65,846,573 (GRCm39) missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65,764,958 (GRCm39) missense probably benign 0.22
R1447:Dnah9 UTSW 11 65,999,308 (GRCm39) missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65,818,612 (GRCm39) missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1470:Dnah9 UTSW 11 65,818,648 (GRCm39) missense probably benign 0.11
R1486:Dnah9 UTSW 11 65,725,098 (GRCm39) missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65,772,587 (GRCm39) missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66,003,156 (GRCm39) missense probably benign
R1617:Dnah9 UTSW 11 65,786,747 (GRCm39) missense probably damaging 1.00
R1623:Dnah9 UTSW 11 65,928,463 (GRCm39) missense probably damaging 1.00
R1626:Dnah9 UTSW 11 65,976,093 (GRCm39) missense probably benign 0.05
R1671:Dnah9 UTSW 11 65,818,789 (GRCm39) missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65,845,650 (GRCm39) nonsense probably null
R1701:Dnah9 UTSW 11 65,802,750 (GRCm39) missense probably damaging 1.00
R1702:Dnah9 UTSW 11 65,976,021 (GRCm39) missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65,805,980 (GRCm39) missense probably benign 0.11
R1718:Dnah9 UTSW 11 66,058,905 (GRCm39) missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65,872,048 (GRCm39) missense probably benign 0.31
R1784:Dnah9 UTSW 11 65,975,846 (GRCm39) missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66,010,420 (GRCm39) critical splice donor site probably null
R1801:Dnah9 UTSW 11 65,846,123 (GRCm39) missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65,740,887 (GRCm39) missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66,009,667 (GRCm39) missense probably benign 0.10
R1840:Dnah9 UTSW 11 65,725,024 (GRCm39) nonsense probably null
R1847:Dnah9 UTSW 11 65,725,212 (GRCm39) missense probably damaging 1.00
R1872:Dnah9 UTSW 11 65,928,316 (GRCm39) missense probably benign 0.16
R1929:Dnah9 UTSW 11 65,867,224 (GRCm39) missense probably benign 0.05
R1969:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65,739,197 (GRCm39) missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65,846,164 (GRCm39) missense probably benign 0.11
R2049:Dnah9 UTSW 11 65,935,509 (GRCm39) missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66,036,261 (GRCm39) missense probably benign 0.31
R2104:Dnah9 UTSW 11 65,951,950 (GRCm39) missense probably damaging 1.00
R2109:Dnah9 UTSW 11 65,928,411 (GRCm39) missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66,008,309 (GRCm39) missense probably damaging 1.00
R2172:Dnah9 UTSW 11 65,963,605 (GRCm39) missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65,750,325 (GRCm39) missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2272:Dnah9 UTSW 11 66,003,188 (GRCm39) missense probably benign 0.37
R2396:Dnah9 UTSW 11 65,975,984 (GRCm39) missense probably benign 0.01
R2398:Dnah9 UTSW 11 65,806,029 (GRCm39) missense probably damaging 1.00
R2418:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2419:Dnah9 UTSW 11 65,986,241 (GRCm39) nonsense probably null
R2510:Dnah9 UTSW 11 65,895,995 (GRCm39) missense probably damaging 1.00
R2680:Dnah9 UTSW 11 65,924,751 (GRCm39) missense probably benign 0.00
R2875:Dnah9 UTSW 11 66,059,287 (GRCm39) missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66,008,414 (GRCm39) missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3237:Dnah9 UTSW 11 65,845,815 (GRCm39) missense probably benign 0.11
R3433:Dnah9 UTSW 11 65,965,938 (GRCm39) missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66,047,734 (GRCm39) nonsense probably null
R3820:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3821:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3822:Dnah9 UTSW 11 65,741,829 (GRCm39) critical splice donor site probably null
R3861:Dnah9 UTSW 11 65,943,820 (GRCm39) splice site probably benign
R3918:Dnah9 UTSW 11 65,761,800 (GRCm39) missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65,725,290 (GRCm39) missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66,024,461 (GRCm39) missense probably benign 0.03
R4072:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4076:Dnah9 UTSW 11 65,975,730 (GRCm39) missense probably benign 0.00
R4097:Dnah9 UTSW 11 65,881,285 (GRCm39) missense probably damaging 1.00
R4409:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 65,976,303 (GRCm39) missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65,872,040 (GRCm39) missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66,009,575 (GRCm39) missense probably benign 0.00
R4434:Dnah9 UTSW 11 65,998,901 (GRCm39) missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65,772,467 (GRCm39) missense probably benign 0.07
R4452:Dnah9 UTSW 11 65,917,908 (GRCm39) missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66,038,215 (GRCm39) missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65,732,192 (GRCm39) missense probably damaging 1.00
R4590:Dnah9 UTSW 11 65,931,218 (GRCm39) missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66,058,978 (GRCm39) missense probably benign
R4655:Dnah9 UTSW 11 65,846,558 (GRCm39) missense probably benign 0.00
R4667:Dnah9 UTSW 11 66,046,357 (GRCm39) missense probably benign
R4718:Dnah9 UTSW 11 65,976,299 (GRCm39) missense probably benign
R4720:Dnah9 UTSW 11 65,967,184 (GRCm39) missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65,724,941 (GRCm39) missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65,818,552 (GRCm39) missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65,764,950 (GRCm39) nonsense probably null
R4963:Dnah9 UTSW 11 65,975,437 (GRCm39) splice site probably null
R5074:Dnah9 UTSW 11 65,740,866 (GRCm39) missense probably damaging 1.00
R5230:Dnah9 UTSW 11 65,975,492 (GRCm39) missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66,003,159 (GRCm39) missense probably benign 0.34
R5364:Dnah9 UTSW 11 65,772,522 (GRCm39) missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 65,920,180 (GRCm39) missense probably damaging 1.00
R5386:Dnah9 UTSW 11 65,920,182 (GRCm39) missense probably damaging 1.00
R5389:Dnah9 UTSW 11 65,986,140 (GRCm39) nonsense probably null
R5541:Dnah9 UTSW 11 66,036,162 (GRCm39) missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65,772,566 (GRCm39) missense probably benign 0.00
R5576:Dnah9 UTSW 11 65,724,922 (GRCm39) splice site probably null
R5648:Dnah9 UTSW 11 65,818,581 (GRCm39) missense probably benign 0.00
R5653:Dnah9 UTSW 11 65,740,806 (GRCm39) missense probably damaging 0.99
R5713:Dnah9 UTSW 11 65,916,049 (GRCm39) missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65,846,065 (GRCm39) missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66,017,427 (GRCm39) missense probably benign 0.01
R5831:Dnah9 UTSW 11 65,998,947 (GRCm39) missense probably benign 0.00
R5847:Dnah9 UTSW 11 65,986,066 (GRCm39) frame shift probably null
R5870:Dnah9 UTSW 11 65,976,036 (GRCm39) missense probably benign 0.01
R5902:Dnah9 UTSW 11 65,916,013 (GRCm39) missense probably benign 0.08
R5918:Dnah9 UTSW 11 65,725,025 (GRCm39) missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65,725,307 (GRCm39) missense probably damaging 1.00
R6065:Dnah9 UTSW 11 66,036,223 (GRCm39) missense possibly damaging 0.65
R6065:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.05
R6086:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
R6086:Dnah9 UTSW 11 65,880,741 (GRCm39) missense probably damaging 0.99
R6102:Dnah9 UTSW 11 65,881,342 (GRCm39) missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66,038,225 (GRCm39) missense probably benign
R6154:Dnah9 UTSW 11 65,746,164 (GRCm39) missense probably benign 0.00
R6262:Dnah9 UTSW 11 65,772,631 (GRCm39) splice site probably null
R6265:Dnah9 UTSW 11 66,058,920 (GRCm39) missense probably benign 0.04
R6290:Dnah9 UTSW 11 65,732,201 (GRCm39) missense probably damaging 1.00
R6345:Dnah9 UTSW 11 65,928,519 (GRCm39) missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65,765,022 (GRCm39) missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65,846,074 (GRCm39) missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66,059,107 (GRCm39) missense probably benign 0.37
R6582:Dnah9 UTSW 11 65,951,923 (GRCm39) missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65,846,192 (GRCm39) missense probably damaging 1.00
R6800:Dnah9 UTSW 11 65,963,565 (GRCm39) critical splice donor site probably null
R6812:Dnah9 UTSW 11 65,872,155 (GRCm39) missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66,008,452 (GRCm39) missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 65,975,975 (GRCm39) missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 65,967,167 (GRCm39) missense probably damaging 1.00
R6977:Dnah9 UTSW 11 65,998,735 (GRCm39) missense probably benign 0.37
R7021:Dnah9 UTSW 11 65,872,057 (GRCm39) missense probably benign
R7161:Dnah9 UTSW 11 65,746,198 (GRCm39) nonsense probably null
R7175:Dnah9 UTSW 11 66,024,463 (GRCm39) missense probably benign 0.03
R7199:Dnah9 UTSW 11 66,009,770 (GRCm39) missense probably benign 0.04
R7231:Dnah9 UTSW 11 65,856,473 (GRCm39) missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65,881,302 (GRCm39) missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65,880,677 (GRCm39) missense probably benign 0.00
R7350:Dnah9 UTSW 11 65,971,404 (GRCm39) missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66,008,233 (GRCm39) critical splice donor site probably null
R7427:Dnah9 UTSW 11 65,846,045 (GRCm39) missense probably benign
R7477:Dnah9 UTSW 11 65,883,557 (GRCm39) missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65,732,240 (GRCm39) missense probably benign 0.01
R7521:Dnah9 UTSW 11 65,880,663 (GRCm39) missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66,016,041 (GRCm39) missense probably benign 0.43
R7659:Dnah9 UTSW 11 65,880,606 (GRCm39) missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66,009,784 (GRCm39) missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65,802,656 (GRCm39) missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65,740,839 (GRCm39) missense probably damaging 1.00
R7808:Dnah9 UTSW 11 65,896,631 (GRCm39) nonsense probably null
R7814:Dnah9 UTSW 11 65,896,486 (GRCm39) missense probably damaging 1.00
R7818:Dnah9 UTSW 11 65,916,037 (GRCm39) missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 65,962,898 (GRCm39) missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65,732,227 (GRCm39) missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 65,908,201 (GRCm39) missense probably benign 0.02
R8232:Dnah9 UTSW 11 65,746,149 (GRCm39) missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65,880,644 (GRCm39) missense probably benign 0.00
R8326:Dnah9 UTSW 11 66,008,452 (GRCm39) missense probably benign 0.01
R8338:Dnah9 UTSW 11 65,732,067 (GRCm39) critical splice donor site probably null
R8356:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66,047,764 (GRCm39) missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65,722,556 (GRCm39) missense probably benign 0.00
R8721:Dnah9 UTSW 11 65,986,124 (GRCm39) missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65,818,816 (GRCm39) missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65,796,057 (GRCm39) missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65,750,309 (GRCm39) missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65,740,742 (GRCm39) missense probably benign 0.13
R8837:Dnah9 UTSW 11 65,746,060 (GRCm39) missense possibly damaging 0.72
R8887:Dnah9 UTSW 11 65,746,210 (GRCm39) missense probably benign 0.01
R8921:Dnah9 UTSW 11 65,802,747 (GRCm39) missense probably benign
R8933:Dnah9 UTSW 11 65,746,078 (GRCm39) missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66,059,226 (GRCm39) missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66,015,938 (GRCm39) critical splice donor site probably null
R8979:Dnah9 UTSW 11 65,895,978 (GRCm39) missense probably benign
R8991:Dnah9 UTSW 11 65,777,506 (GRCm39) missense probably damaging 0.96
R9016:Dnah9 UTSW 11 65,998,856 (GRCm39) missense probably damaging 0.99
R9025:Dnah9 UTSW 11 65,896,651 (GRCm39) missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65,845,680 (GRCm39) missense
R9047:Dnah9 UTSW 11 65,962,925 (GRCm39) missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66,008,464 (GRCm39) missense probably benign 0.21
R9113:Dnah9 UTSW 11 65,880,713 (GRCm39) missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66,021,457 (GRCm39) missense probably damaging 1.00
R9187:Dnah9 UTSW 11 65,895,972 (GRCm39) missense probably benign
R9198:Dnah9 UTSW 11 65,846,570 (GRCm39) missense probably benign 0.02
R9203:Dnah9 UTSW 11 65,746,113 (GRCm39) missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 65,924,751 (GRCm39) missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65,786,731 (GRCm39) missense probably benign 0.30
R9265:Dnah9 UTSW 11 65,732,081 (GRCm39) missense probably benign 0.01
R9307:Dnah9 UTSW 11 65,976,300 (GRCm39) missense probably benign 0.14
R9336:Dnah9 UTSW 11 65,761,775 (GRCm39) missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65,838,368 (GRCm39) missense probably damaging 1.00
R9498:Dnah9 UTSW 11 65,739,199 (GRCm39) missense probably damaging 0.99
R9508:Dnah9 UTSW 11 65,725,089 (GRCm39) missense probably damaging 1.00
R9524:Dnah9 UTSW 11 65,976,309 (GRCm39) missense possibly damaging 0.92
R9577:Dnah9 UTSW 11 65,867,347 (GRCm39) missense probably benign 0.00
R9583:Dnah9 UTSW 11 65,856,507 (GRCm39) missense probably damaging 1.00
R9587:Dnah9 UTSW 11 65,999,217 (GRCm39) missense probably null 0.92
R9612:Dnah9 UTSW 11 65,818,475 (GRCm39) missense probably benign 0.00
R9748:Dnah9 UTSW 11 65,976,290 (GRCm39) missense possibly damaging 0.51
R9749:Dnah9 UTSW 11 65,986,202 (GRCm39) missense probably damaging 1.00
R9759:Dnah9 UTSW 11 65,965,944 (GRCm39) missense probably null 0.93
R9784:Dnah9 UTSW 11 65,975,960 (GRCm39) missense probably damaging 0.99
V3553:Dnah9 UTSW 11 65,860,902 (GRCm39) missense probably damaging 1.00
X0027:Dnah9 UTSW 11 65,976,305 (GRCm39) missense probably benign 0.07
X0028:Dnah9 UTSW 11 65,881,278 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,860,910 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,818,679 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,786,798 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,963,661 (GRCm39) missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65,928,300 (GRCm39) missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66,017,476 (GRCm39) missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1186:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1187:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1188:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1189:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1190:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1191:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 66,038,207 (GRCm39) missense probably benign
Z1192:Dnah9 UTSW 11 65,976,000 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCATGGAGGGCAACTTGGAG -3'
(R):5'- CCATCACCTTCAGAAACGTAATTG -3'

Sequencing Primer
(F):5'- GCAACTTGGAGGGAAAGGATG -3'
(R):5'- CACCTTCAGAAACGTAATTGTTCTTG -3'
Posted On 2021-08-02