Incidental Mutation 'R8887:Slc9a2'
ID 677363
Institutional Source Beutler Lab
Gene Symbol Slc9a2
Ensembl Gene ENSMUSG00000026062
Gene Name solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms 2210416H12Rik, NHE2, 4932415O19Rik
MMRRC Submission 068752-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 40720872-40808045 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40758009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 183 (I183V)
Ref Sequence ENSEMBL: ENSMUSP00000027231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027231] [ENSMUST00000192345]
AlphaFold Q3ZAS0
Predicted Effect probably benign
Transcript: ENSMUST00000027231
AA Change: I183V

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000027231
Gene: ENSMUSG00000026062
AA Change: I183V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 486 1.4e-95 PFAM
low complexity region 528 543 N/A INTRINSIC
Pfam:NEXCaM_BD 576 685 3e-44 PFAM
low complexity region 738 753 N/A INTRINSIC
low complexity region 788 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192345
AA Change: I183V

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000142144
Gene: ENSMUSG00000026062
AA Change: I183V

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 40 60 N/A INTRINSIC
Pfam:Na_H_Exchanger 85 336 2.5e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
PHENOTYPE: Gastric acid secretion is impaired in homozygous mutant mice. The gastric mucosa becomes inflamed and exhibits an altered cellular composition. Mutant mice do not breed well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,175,285 (GRCm39) T76A probably benign Het
Actn1 A G 12: 80,215,197 (GRCm39) C860R probably damaging Het
Adam23 T A 1: 63,554,744 (GRCm39) L170Q probably damaging Het
Afdn C T 17: 14,116,401 (GRCm39) R1620* probably null Het
Agfg1 A G 1: 82,848,525 (GRCm39) probably benign Het
Aire A G 10: 77,870,298 (GRCm39) S476P probably damaging Het
Arhgef26 A G 3: 62,247,401 (GRCm39) T162A probably benign Het
Atp1a2 T C 1: 172,113,222 (GRCm39) Q487R probably null Het
BC048507 T A 13: 68,011,628 (GRCm39) C2S probably benign Het
Bltp1 G T 3: 37,087,503 (GRCm39) A615S possibly damaging Het
Bnc2 A C 4: 84,209,707 (GRCm39) probably benign Het
Bop1 C T 15: 76,338,524 (GRCm39) G473R probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
Cacna1i T C 15: 80,258,894 (GRCm39) V1201A possibly damaging Het
Cecr2 C A 6: 120,715,162 (GRCm39) T249K probably damaging Het
Clca3a2 C A 3: 144,790,810 (GRCm39) G421* probably null Het
Clec1b A T 6: 129,378,703 (GRCm39) probably null Het
Cnksr3 C T 10: 7,104,467 (GRCm39) D79N probably damaging Het
Col15a1 A G 4: 47,287,091 (GRCm39) Q843R probably damaging Het
Col6a3 T C 1: 90,755,948 (GRCm39) S114G probably benign Het
Corin A T 5: 72,486,953 (GRCm39) probably null Het
Cyp2u1 A G 3: 131,096,503 (GRCm39) Y92H probably damaging Het
Dcbld2 T C 16: 58,229,270 (GRCm39) L51P probably damaging Het
Dip2c T A 13: 9,673,989 (GRCm39) probably benign Het
Dlc1 A T 8: 37,051,481 (GRCm39) V299E probably benign Het
Dlgap2 G A 8: 14,229,682 (GRCm39) probably null Het
Dnah1 A G 14: 31,032,997 (GRCm39) L346P probably damaging Het
Dnah9 T C 11: 65,746,210 (GRCm39) T3968A probably benign Het
Duox2 A C 2: 122,120,044 (GRCm39) M822R probably null Het
E2f7 A T 10: 110,610,674 (GRCm39) Q433L probably benign Het
Eif3k A C 7: 28,679,901 (GRCm39) Y42* probably null Het
Elmod3 A G 6: 72,563,494 (GRCm39) S45P probably damaging Het
Emilin3 C A 2: 160,751,108 (GRCm39) V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 (GRCm39) F283L probably benign Het
Fbxw7 T C 3: 84,876,549 (GRCm39) Y358H Het
G430095P16Rik A G 8: 85,453,043 (GRCm39) N10S unknown Het
Gldc A G 19: 30,111,156 (GRCm39) V540A possibly damaging Het
Gm3667 T A 14: 18,271,553 (GRCm39) E67D probably benign Het
Golga3 T A 5: 110,353,626 (GRCm39) probably benign Het
H60c T C 10: 3,217,255 (GRCm39) E38G probably benign Het
Hectd4 A G 5: 121,433,541 (GRCm39) D952G probably benign Het
Hoxb8 T A 11: 96,175,223 (GRCm39) L220Q probably damaging Het
Ice1 A T 13: 70,751,050 (GRCm39) L1679M probably damaging Het
Ifi202b T A 1: 173,802,480 (GRCm39) Y118F probably damaging Het
Ift122 A T 6: 115,868,880 (GRCm39) T456S probably benign Het
Ighg3 G A 12: 113,323,845 (GRCm39) T181I Het
Ighv1-66 C A 12: 115,557,032 (GRCm39) V17F probably damaging Het
Ighv5-12-4 A G 12: 113,726,130 (GRCm39) V31A possibly damaging Het
Ints12 T A 3: 132,815,003 (GRCm39) N403K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kalrn A C 16: 34,047,496 (GRCm39) N908K probably benign Het
Kctd9 G A 14: 67,962,016 (GRCm39) V20I unknown Het
Krt78 G T 15: 101,861,746 (GRCm39) L167M probably damaging Het
Ldb1 T C 19: 46,023,294 (GRCm39) E206G probably damaging Het
Lig1 A G 7: 13,030,713 (GRCm39) Y455C probably damaging Het
Ltbp1 T G 17: 75,486,077 (GRCm39) I34S probably damaging Het
Map2 T C 1: 66,454,758 (GRCm39) I1216T possibly damaging Het
Mex3c T C 18: 73,706,800 (GRCm39) V229A probably damaging Het
Mfsd11 T C 11: 116,745,526 (GRCm39) probably null Het
Mroh1 A G 15: 76,331,474 (GRCm39) T1233A probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nipbl A T 15: 8,391,271 (GRCm39) H234Q probably damaging Het
Npc1l1 G A 11: 6,175,665 (GRCm39) P549S probably damaging Het
Or12d2 A T 17: 37,624,642 (GRCm39) L211Q probably damaging Het
Or4c3 A G 2: 89,852,269 (GRCm39) V47A probably benign Het
Or5h22 A T 16: 58,894,846 (GRCm39) V199D possibly damaging Het
Or5w22 A G 2: 87,363,187 (GRCm39) D270G possibly damaging Het
Or6c3b A T 10: 129,527,372 (GRCm39) Y179* probably null Het
Padi3 A T 4: 140,523,795 (GRCm39) C228* probably null Het
Palld T A 8: 61,986,512 (GRCm39) D1015V unknown Het
Pcna-ps2 A T 19: 9,261,488 (GRCm39) Y249F probably benign Het
Pelo C T 13: 115,225,451 (GRCm39) C258Y probably benign Het
Ppp1r13b A T 12: 111,803,430 (GRCm39) probably benign Het
Pramel26 A G 4: 143,539,257 (GRCm39) F79L probably damaging Het
Prdm2 A G 4: 142,860,771 (GRCm39) W840R probably damaging Het
Prkcg A G 7: 3,370,857 (GRCm39) D428G possibly damaging Het
Pus7 G A 5: 23,948,476 (GRCm39) R571* probably null Het
Rab11fip3 A G 17: 26,286,927 (GRCm39) C409R possibly damaging Het
Rdh13 T C 7: 4,434,522 (GRCm39) D186G probably damaging Het
Rslcan18 T A 13: 67,246,793 (GRCm39) H273L probably damaging Het
Rxfp1 T A 3: 79,559,289 (GRCm39) probably benign Het
Sh3bp1 T A 15: 78,788,540 (GRCm39) probably null Het
Siglecg T A 7: 43,058,008 (GRCm39) S9T probably benign Het
Slc9a1 T C 4: 133,139,258 (GRCm39) F159L probably benign Het
St6galnac4 A G 2: 32,484,110 (GRCm39) M103V probably damaging Het
Tbc1d30 T C 10: 121,187,059 (GRCm39) D42G possibly damaging Het
Tlr5 C A 1: 182,801,332 (GRCm39) T212K probably benign Het
Trim43b T G 9: 88,969,642 (GRCm39) I269L probably benign Het
Ttll6 T C 11: 96,047,492 (GRCm39) L697P possibly damaging Het
Ttn T G 2: 76,549,239 (GRCm39) T31813P probably damaging Het
Ttn A T 2: 76,571,932 (GRCm39) D26320E probably damaging Het
Uba6 A G 5: 86,307,061 (GRCm39) probably null Het
Usp1 C G 4: 98,819,185 (GRCm39) Q216E probably benign Het
Vcan T C 13: 89,853,026 (GRCm39) T645A probably benign Het
Wdr64 C A 1: 175,599,850 (GRCm39) P559H probably benign Het
Zfat T C 15: 68,056,315 (GRCm39) Y247C probably damaging Het
Zfp979 A T 4: 147,698,219 (GRCm39) N163K probably damaging Het
Other mutations in Slc9a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Slc9a2 APN 1 40,806,897 (GRCm39) missense probably benign
IGL00487:Slc9a2 APN 1 40,781,818 (GRCm39) missense probably damaging 0.99
IGL00500:Slc9a2 APN 1 40,802,743 (GRCm39) missense possibly damaging 0.95
IGL01445:Slc9a2 APN 1 40,757,970 (GRCm39) missense possibly damaging 0.51
IGL02060:Slc9a2 APN 1 40,795,453 (GRCm39) missense probably damaging 0.99
IGL02813:Slc9a2 APN 1 40,781,829 (GRCm39) missense probably damaging 1.00
IGL02894:Slc9a2 APN 1 40,802,762 (GRCm39) missense probably benign 0.20
IGL02939:Slc9a2 APN 1 40,781,863 (GRCm39) missense probably damaging 1.00
IGL03193:Slc9a2 APN 1 40,795,431 (GRCm39) missense probably benign 0.00
putty UTSW 1 40,781,813 (GRCm39) nonsense probably null
E0370:Slc9a2 UTSW 1 40,802,701 (GRCm39) critical splice acceptor site probably null
PIT4377001:Slc9a2 UTSW 1 40,783,001 (GRCm39) missense probably damaging 1.00
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0009:Slc9a2 UTSW 1 40,802,762 (GRCm39) missense probably benign 0.38
R0152:Slc9a2 UTSW 1 40,781,964 (GRCm39) missense probably damaging 1.00
R0374:Slc9a2 UTSW 1 40,783,017 (GRCm39) missense possibly damaging 0.93
R1386:Slc9a2 UTSW 1 40,758,178 (GRCm39) missense probably damaging 1.00
R1485:Slc9a2 UTSW 1 40,765,548 (GRCm39) missense probably damaging 1.00
R1712:Slc9a2 UTSW 1 40,802,770 (GRCm39) missense possibly damaging 0.90
R1779:Slc9a2 UTSW 1 40,781,803 (GRCm39) missense probably damaging 0.99
R2051:Slc9a2 UTSW 1 40,765,597 (GRCm39) missense probably damaging 1.00
R2166:Slc9a2 UTSW 1 40,781,928 (GRCm39) missense probably damaging 1.00
R2513:Slc9a2 UTSW 1 40,781,768 (GRCm39) splice site probably null
R3612:Slc9a2 UTSW 1 40,758,218 (GRCm39) splice site probably null
R4631:Slc9a2 UTSW 1 40,801,078 (GRCm39) missense possibly damaging 0.66
R4760:Slc9a2 UTSW 1 40,801,076 (GRCm39) missense probably damaging 1.00
R4768:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4769:Slc9a2 UTSW 1 40,765,534 (GRCm39) missense probably damaging 1.00
R4815:Slc9a2 UTSW 1 40,758,009 (GRCm39) missense probably benign 0.00
R4920:Slc9a2 UTSW 1 40,794,878 (GRCm39) missense probably benign 0.05
R5191:Slc9a2 UTSW 1 40,783,053 (GRCm39) missense probably damaging 1.00
R5963:Slc9a2 UTSW 1 40,721,196 (GRCm39) missense possibly damaging 0.94
R6322:Slc9a2 UTSW 1 40,781,813 (GRCm39) nonsense probably null
R6453:Slc9a2 UTSW 1 40,781,781 (GRCm39) missense possibly damaging 0.64
R6685:Slc9a2 UTSW 1 40,758,069 (GRCm39) missense probably damaging 0.99
R7088:Slc9a2 UTSW 1 40,765,539 (GRCm39) missense probably damaging 1.00
R7302:Slc9a2 UTSW 1 40,806,828 (GRCm39) missense possibly damaging 0.58
R7450:Slc9a2 UTSW 1 40,720,995 (GRCm39) start gained probably benign
R7670:Slc9a2 UTSW 1 40,758,157 (GRCm39) missense probably damaging 1.00
R7970:Slc9a2 UTSW 1 40,765,374 (GRCm39) missense probably damaging 0.98
R8104:Slc9a2 UTSW 1 40,757,809 (GRCm39) missense probably damaging 1.00
R8776:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Slc9a2 UTSW 1 40,781,889 (GRCm39) missense probably damaging 1.00
R9028:Slc9a2 UTSW 1 40,765,612 (GRCm39) missense probably damaging 1.00
R9189:Slc9a2 UTSW 1 40,794,944 (GRCm39) missense probably benign 0.21
R9245:Slc9a2 UTSW 1 40,805,460 (GRCm39) missense probably benign 0.27
R9250:Slc9a2 UTSW 1 40,806,987 (GRCm39) missense probably benign 0.00
R9400:Slc9a2 UTSW 1 40,758,211 (GRCm39) missense possibly damaging 0.65
R9512:Slc9a2 UTSW 1 40,721,258 (GRCm39) missense probably damaging 0.98
R9583:Slc9a2 UTSW 1 40,721,061 (GRCm39) missense probably benign
X0054:Slc9a2 UTSW 1 40,781,847 (GRCm39) missense probably damaging 0.99
Z1176:Slc9a2 UTSW 1 40,806,871 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTCGGGCTTCTACTGG -3'
(R):5'- ACTGCATCGTTGAGCAGAG -3'

Sequencing Primer
(F):5'- CTTCTACTGGGTGGGATTATCTTC -3'
(R):5'- TGCATCGTTGAGCAGAGACTCG -3'
Posted On 2021-08-02