Mutagenetix > Incidental Mutations

Incidental Mutation 'R8887:Prdm2'

677389

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143134201 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 840 (W840R)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably damaging
Transcript: ENSMUST00000105778
AA Change: W840R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: W840R

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	T	3: 37,033,354	A615S	possibly damaging	Het
Acsbg2	T	C	17: 56,868,285	T76A	probably benign	Het
Actn1	A	G	12: 80,168,423	C860R	probably damaging	Het
Adam23	T	A	1: 63,515,585	L170Q	probably damaging	Het
Afdn	C	T	17: 13,896,139	R1620*	probably null	Het
Agfg1	A	G	1: 82,870,804		probably benign	Het
Aire	A	G	10: 78,034,464	S476P	probably damaging	Het
Arhgef26	A	G	3: 62,339,980	T162A	probably benign	Het
Atp1a2	T	C	1: 172,285,655	Q487R	probably null	Het
BC048507	T	A	13: 67,863,509	C2S	probably benign	Het
Bnc2	A	C	4: 84,291,470		probably benign	Het
Bop1	C	T	15: 76,454,324	G473R	probably damaging	Het
C1galt1	A	G	6: 7,866,379	E75G	probably benign	Het
Cacna1i	T	C	15: 80,374,693	V1201A	possibly damaging	Het
Cecr2	C	A	6: 120,738,201	T249K	probably damaging	Het
Clca2	C	A	3: 145,085,049	G421*	probably null	Het
Clec1b	A	T	6: 129,401,740		probably null	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Col15a1	A	G	4: 47,287,091	Q843R	probably damaging	Het
Col6a3	T	C	1: 90,828,226	S114G	probably benign	Het
Corin	A	T	5: 72,329,610		probably null	Het
Cyp2u1	A	G	3: 131,302,854	Y92H	probably damaging	Het
Dcbld2	T	C	16: 58,408,907	L51P	probably damaging	Het
Dip2c	T	A	13: 9,623,953		probably benign	Het
Dlc1	A	T	8: 36,584,327	V299E	probably benign	Het
Dlgap2	G	A	8: 14,179,682		probably null	Het
Dnah1	A	G	14: 31,311,040	L346P	probably damaging	Het
Dnah9	T	C	11: 65,855,384	T3968A	probably benign	Het
Duox2	A	C	2: 122,289,563	M822R	probably null	Het
E2f7	A	T	10: 110,774,813	Q433L	probably benign	Het
Eif3k	A	C	7: 28,980,476	Y42*	probably null	Het
Elmod3	A	G	6: 72,586,511	S45P	probably damaging	Het
Emilin3	C	A	2: 160,909,188	V214F	possibly damaging	Het
Fbxo10	A	T	4: 45,058,887	F283L	probably benign	Het
Fbxw7	T	C	3: 84,969,242	Y358H		Het
G430095P16Rik	A	G	8: 84,726,414	N10S	unknown	Het
Gldc	A	G	19: 30,133,756	V540A	possibly damaging	Het
Gm13084	A	G	4: 143,812,687	F79L	probably damaging	Het
Gm3667	T	A	14: 6,874,222	E67D	probably benign	Het
Golga3	T	A	5: 110,205,760		probably benign	Het
H60c	T	C	10: 3,267,255	E38G	probably benign	Het
Hectd4	A	G	5: 121,295,478	D952G	probably benign	Het
Hoxb8	T	A	11: 96,284,397	L220Q	probably damaging	Het
Ice1	A	T	13: 70,602,931	L1679M	probably damaging	Het
Ifi202b	T	A	1: 173,974,914	Y118F	probably damaging	Het
Ift122	A	T	6: 115,891,919	T456S	probably benign	Het
Ighg3	G	A	12: 113,360,225	T181I		Het
Ighv1-66	C	A	12: 115,593,412	V17F	probably damaging	Het
Ighv5-12-4	A	G	12: 113,762,510	V31A	possibly damaging	Het
Ints12	T	A	3: 133,109,242	N403K	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kalrn	A	C	16: 34,227,126	N908K	probably benign	Het
Kctd9	G	A	14: 67,724,567	V20I	unknown	Het
Krt78	G	T	15: 101,953,311	L167M	probably damaging	Het
Ldb1	T	C	19: 46,034,855	E206G	probably damaging	Het
Lig1	A	G	7: 13,296,787	Y455C	probably damaging	Het
Ltbp1	T	G	17: 75,179,082	I34S	probably damaging	Het
Map2	T	C	1: 66,415,599	I1216T	possibly damaging	Het
Mex3c	T	C	18: 73,573,729	V229A	probably damaging	Het
Mfsd11	T	C	11: 116,854,700		probably null	Het
Mroh1	A	G	15: 76,447,274	T1233A	probably benign	Het
Myct1	C	T	10: 5,604,208	T25I	probably damaging	Het
Nipbl	A	T	15: 8,361,787	H234Q	probably damaging	Het
Npc1l1	G	A	11: 6,225,665	P549S	probably damaging	Het
Olfr102	A	T	17: 37,313,751	L211Q	probably damaging	Het
Olfr1264	A	G	2: 90,021,925	V47A	probably benign	Het
Olfr153	A	G	2: 87,532,843	D270G	possibly damaging	Het
Olfr190	A	T	16: 59,074,483	V199D	possibly damaging	Het
Olfr803	A	T	10: 129,691,503	Y179*	probably null	Het
Padi3	A	T	4: 140,796,484	C228*	probably null	Het
Palld	T	A	8: 61,533,478	D1015V	unknown	Het
Pcna-ps2	A	T	19: 9,284,124	Y249F	probably benign	Het
Pelo	C	T	13: 115,088,915	C258Y	probably benign	Het
Ppp1r13b	A	T	12: 111,836,996		probably benign	Het
Prkcg	A	G	7: 3,322,341	D428G	possibly damaging	Het
Pus7	G	A	5: 23,743,478	R571*	probably null	Het
Rab11fip3	A	G	17: 26,067,953	C409R	possibly damaging	Het
Rdh13	T	C	7: 4,431,523	D186G	probably damaging	Het
Rslcan18	T	A	13: 67,098,729	H273L	probably damaging	Het
Rxfp1	T	A	3: 79,651,982		probably benign	Het
Sh3bp1	T	A	15: 78,904,340		probably null	Het
Siglecg	T	A	7: 43,408,584	S9T	probably benign	Het
Slc9a1	T	C	4: 133,411,947	F159L	probably benign	Het
Slc9a2	A	G	1: 40,718,849	I183V	probably benign	Het
St6galnac4	A	G	2: 32,594,098	M103V	probably damaging	Het
Tbc1d30	T	C	10: 121,351,154	D42G	possibly damaging	Het
Tlr5	C	A	1: 182,973,767	T212K	probably benign	Het
Trim43b	T	G	9: 89,087,589	I269L	probably benign	Het
Ttll6	T	C	11: 96,156,666	L697P	possibly damaging	Het
Ttn	T	G	2: 76,718,895	T31813P	probably damaging	Het
Ttn	A	T	2: 76,741,588	D26320E	probably damaging	Het
Uba6	A	G	5: 86,159,202		probably null	Het
Usp1	C	G	4: 98,930,948	Q216E	probably benign	Het
Vcan	T	C	13: 89,704,907	T645A	probably benign	Het
Wdr64	C	A	1: 175,772,284	P559H	probably benign	Het
Zfat	T	C	15: 68,184,466	Y247C	probably damaging	Het
Zfp979	A	T	4: 147,613,762	N163K	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GATTTACAAGGACTTGGGCTCCTG -3'
(R):5'- TCACCAGCGTGGAGTTTGTC -3'

Sequencing Primer
(F):5'- TCCTGGTCGCCTCTGGTG -3'
(R):5'- AGTTTGTCTGGGAGAGATGAGAG -3'

Posted On

2021-08-02