Incidental Mutation 'R8887:Siglecg'
ID 677405
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
MMRRC Submission 068752-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43058008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 9 (S9T)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: S9T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: S9T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,175,285 (GRCm39) T76A probably benign Het
Actn1 A G 12: 80,215,197 (GRCm39) C860R probably damaging Het
Adam23 T A 1: 63,554,744 (GRCm39) L170Q probably damaging Het
Afdn C T 17: 14,116,401 (GRCm39) R1620* probably null Het
Agfg1 A G 1: 82,848,525 (GRCm39) probably benign Het
Aire A G 10: 77,870,298 (GRCm39) S476P probably damaging Het
Arhgef26 A G 3: 62,247,401 (GRCm39) T162A probably benign Het
Atp1a2 T C 1: 172,113,222 (GRCm39) Q487R probably null Het
BC048507 T A 13: 68,011,628 (GRCm39) C2S probably benign Het
Bltp1 G T 3: 37,087,503 (GRCm39) A615S possibly damaging Het
Bnc2 A C 4: 84,209,707 (GRCm39) probably benign Het
Bop1 C T 15: 76,338,524 (GRCm39) G473R probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
Cacna1i T C 15: 80,258,894 (GRCm39) V1201A possibly damaging Het
Cecr2 C A 6: 120,715,162 (GRCm39) T249K probably damaging Het
Clca3a2 C A 3: 144,790,810 (GRCm39) G421* probably null Het
Clec1b A T 6: 129,378,703 (GRCm39) probably null Het
Cnksr3 C T 10: 7,104,467 (GRCm39) D79N probably damaging Het
Col15a1 A G 4: 47,287,091 (GRCm39) Q843R probably damaging Het
Col6a3 T C 1: 90,755,948 (GRCm39) S114G probably benign Het
Corin A T 5: 72,486,953 (GRCm39) probably null Het
Cyp2u1 A G 3: 131,096,503 (GRCm39) Y92H probably damaging Het
Dcbld2 T C 16: 58,229,270 (GRCm39) L51P probably damaging Het
Dip2c T A 13: 9,673,989 (GRCm39) probably benign Het
Dlc1 A T 8: 37,051,481 (GRCm39) V299E probably benign Het
Dlgap2 G A 8: 14,229,682 (GRCm39) probably null Het
Dnah1 A G 14: 31,032,997 (GRCm39) L346P probably damaging Het
Dnah9 T C 11: 65,746,210 (GRCm39) T3968A probably benign Het
Duox2 A C 2: 122,120,044 (GRCm39) M822R probably null Het
E2f7 A T 10: 110,610,674 (GRCm39) Q433L probably benign Het
Eif3k A C 7: 28,679,901 (GRCm39) Y42* probably null Het
Elmod3 A G 6: 72,563,494 (GRCm39) S45P probably damaging Het
Emilin3 C A 2: 160,751,108 (GRCm39) V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 (GRCm39) F283L probably benign Het
Fbxw7 T C 3: 84,876,549 (GRCm39) Y358H Het
G430095P16Rik A G 8: 85,453,043 (GRCm39) N10S unknown Het
Gldc A G 19: 30,111,156 (GRCm39) V540A possibly damaging Het
Gm3667 T A 14: 18,271,553 (GRCm39) E67D probably benign Het
Golga3 T A 5: 110,353,626 (GRCm39) probably benign Het
H60c T C 10: 3,217,255 (GRCm39) E38G probably benign Het
Hectd4 A G 5: 121,433,541 (GRCm39) D952G probably benign Het
Hoxb8 T A 11: 96,175,223 (GRCm39) L220Q probably damaging Het
Ice1 A T 13: 70,751,050 (GRCm39) L1679M probably damaging Het
Ifi202b T A 1: 173,802,480 (GRCm39) Y118F probably damaging Het
Ift122 A T 6: 115,868,880 (GRCm39) T456S probably benign Het
Ighg3 G A 12: 113,323,845 (GRCm39) T181I Het
Ighv1-66 C A 12: 115,557,032 (GRCm39) V17F probably damaging Het
Ighv5-12-4 A G 12: 113,726,130 (GRCm39) V31A possibly damaging Het
Ints12 T A 3: 132,815,003 (GRCm39) N403K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kalrn A C 16: 34,047,496 (GRCm39) N908K probably benign Het
Kctd9 G A 14: 67,962,016 (GRCm39) V20I unknown Het
Krt78 G T 15: 101,861,746 (GRCm39) L167M probably damaging Het
Ldb1 T C 19: 46,023,294 (GRCm39) E206G probably damaging Het
Lig1 A G 7: 13,030,713 (GRCm39) Y455C probably damaging Het
Ltbp1 T G 17: 75,486,077 (GRCm39) I34S probably damaging Het
Map2 T C 1: 66,454,758 (GRCm39) I1216T possibly damaging Het
Mex3c T C 18: 73,706,800 (GRCm39) V229A probably damaging Het
Mfsd11 T C 11: 116,745,526 (GRCm39) probably null Het
Mroh1 A G 15: 76,331,474 (GRCm39) T1233A probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nipbl A T 15: 8,391,271 (GRCm39) H234Q probably damaging Het
Npc1l1 G A 11: 6,175,665 (GRCm39) P549S probably damaging Het
Or12d2 A T 17: 37,624,642 (GRCm39) L211Q probably damaging Het
Or4c3 A G 2: 89,852,269 (GRCm39) V47A probably benign Het
Or5h22 A T 16: 58,894,846 (GRCm39) V199D possibly damaging Het
Or5w22 A G 2: 87,363,187 (GRCm39) D270G possibly damaging Het
Or6c3b A T 10: 129,527,372 (GRCm39) Y179* probably null Het
Padi3 A T 4: 140,523,795 (GRCm39) C228* probably null Het
Palld T A 8: 61,986,512 (GRCm39) D1015V unknown Het
Pcna-ps2 A T 19: 9,261,488 (GRCm39) Y249F probably benign Het
Pelo C T 13: 115,225,451 (GRCm39) C258Y probably benign Het
Ppp1r13b A T 12: 111,803,430 (GRCm39) probably benign Het
Pramel26 A G 4: 143,539,257 (GRCm39) F79L probably damaging Het
Prdm2 A G 4: 142,860,771 (GRCm39) W840R probably damaging Het
Prkcg A G 7: 3,370,857 (GRCm39) D428G possibly damaging Het
Pus7 G A 5: 23,948,476 (GRCm39) R571* probably null Het
Rab11fip3 A G 17: 26,286,927 (GRCm39) C409R possibly damaging Het
Rdh13 T C 7: 4,434,522 (GRCm39) D186G probably damaging Het
Rslcan18 T A 13: 67,246,793 (GRCm39) H273L probably damaging Het
Rxfp1 T A 3: 79,559,289 (GRCm39) probably benign Het
Sh3bp1 T A 15: 78,788,540 (GRCm39) probably null Het
Slc9a1 T C 4: 133,139,258 (GRCm39) F159L probably benign Het
Slc9a2 A G 1: 40,758,009 (GRCm39) I183V probably benign Het
St6galnac4 A G 2: 32,484,110 (GRCm39) M103V probably damaging Het
Tbc1d30 T C 10: 121,187,059 (GRCm39) D42G possibly damaging Het
Tlr5 C A 1: 182,801,332 (GRCm39) T212K probably benign Het
Trim43b T G 9: 88,969,642 (GRCm39) I269L probably benign Het
Ttll6 T C 11: 96,047,492 (GRCm39) L697P possibly damaging Het
Ttn T G 2: 76,549,239 (GRCm39) T31813P probably damaging Het
Ttn A T 2: 76,571,932 (GRCm39) D26320E probably damaging Het
Uba6 A G 5: 86,307,061 (GRCm39) probably null Het
Usp1 C G 4: 98,819,185 (GRCm39) Q216E probably benign Het
Vcan T C 13: 89,853,026 (GRCm39) T645A probably benign Het
Wdr64 C A 1: 175,599,850 (GRCm39) P559H probably benign Het
Zfat T C 15: 68,056,315 (GRCm39) Y247C probably damaging Het
Zfp979 A T 4: 147,698,219 (GRCm39) N163K probably damaging Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8554:Siglecg UTSW 7 43,058,320 (GRCm39) missense probably benign 0.01
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCCAAGGGCCAAATGC -3'
(R):5'- GCTCTCCATCTGACCTTGAG -3'

Sequencing Primer
(F):5'- GGCCAAATGCTCCATAAAACATGG -3'
(R):5'- ATCTGACCTTGAGGCCCTG -3'
Posted On 2021-08-02