Mutagenetix > Incidental Mutation

Incidental Mutation 'R8887:Dnah9'

677419

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

068752-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.363) question?

Stock #

R8887 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65855384 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 3968 (T3968A)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000080665
AA Change: T3968A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: T3968A

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152386

SMART Domains

Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752

Domain	Start	End	E-Value	Type
Pfam:AAA_7	1	258	3e-155	PFAM
Pfam:AAA_8	336	603	3.9e-166	PFAM
Pfam:MT	615	958	2.3e-208	PFAM
Pfam:AAA_9	980	1202	1.1e-87	PFAM
Pfam:Dynein_heavy	1336	1514	2.4e-52	PFAM
Pfam:Dynein_heavy	1508	1956	8.6e-155	PFAM

Meta Mutation Damage Score

0.1849

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	T	3: 37,033,354	A615S	possibly damaging	Het
Acsbg2	T	C	17: 56,868,285	T76A	probably benign	Het
Actn1	A	G	12: 80,168,423	C860R	probably damaging	Het
Adam23	T	A	1: 63,515,585	L170Q	probably damaging	Het
Afdn	C	T	17: 13,896,139	R1620*	probably null	Het
Agfg1	A	G	1: 82,870,804		probably benign	Het
Aire	A	G	10: 78,034,464	S476P	probably damaging	Het
Arhgef26	A	G	3: 62,339,980	T162A	probably benign	Het
Atp1a2	T	C	1: 172,285,655	Q487R	probably null	Het
BC048507	T	A	13: 67,863,509	C2S	probably benign	Het
Bnc2	A	C	4: 84,291,470		probably benign	Het
Bop1	C	T	15: 76,454,324	G473R	probably damaging	Het
C1galt1	A	G	6: 7,866,379	E75G	probably benign	Het
Cacna1i	T	C	15: 80,374,693	V1201A	possibly damaging	Het
Cecr2	C	A	6: 120,738,201	T249K	probably damaging	Het
Clca2	C	A	3: 145,085,049	G421*	probably null	Het
Clec1b	A	T	6: 129,401,740		probably null	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Col15a1	A	G	4: 47,287,091	Q843R	probably damaging	Het
Col6a3	T	C	1: 90,828,226	S114G	probably benign	Het
Corin	A	T	5: 72,329,610		probably null	Het
Cyp2u1	A	G	3: 131,302,854	Y92H	probably damaging	Het
Dcbld2	T	C	16: 58,408,907	L51P	probably damaging	Het
Dip2c	T	A	13: 9,623,953		probably benign	Het
Dlc1	A	T	8: 36,584,327	V299E	probably benign	Het
Dlgap2	G	A	8: 14,179,682		probably null	Het
Dnah1	A	G	14: 31,311,040	L346P	probably damaging	Het
Duox2	A	C	2: 122,289,563	M822R	probably null	Het
E2f7	A	T	10: 110,774,813	Q433L	probably benign	Het
Eif3k	A	C	7: 28,980,476	Y42*	probably null	Het
Elmod3	A	G	6: 72,586,511	S45P	probably damaging	Het
Emilin3	C	A	2: 160,909,188	V214F	possibly damaging	Het
Fbxo10	A	T	4: 45,058,887	F283L	probably benign	Het
Fbxw7	T	C	3: 84,969,242	Y358H		Het
G430095P16Rik	A	G	8: 84,726,414	N10S	unknown	Het
Gldc	A	G	19: 30,133,756	V540A	possibly damaging	Het
Gm13084	A	G	4: 143,812,687	F79L	probably damaging	Het
Gm3667	T	A	14: 6,874,222	E67D	probably benign	Het
Golga3	T	A	5: 110,205,760		probably benign	Het
H60c	T	C	10: 3,267,255	E38G	probably benign	Het
Hectd4	A	G	5: 121,295,478	D952G	probably benign	Het
Hoxb8	T	A	11: 96,284,397	L220Q	probably damaging	Het
Ice1	A	T	13: 70,602,931	L1679M	probably damaging	Het
Ifi202b	T	A	1: 173,974,914	Y118F	probably damaging	Het
Ift122	A	T	6: 115,891,919	T456S	probably benign	Het
Ighg3	G	A	12: 113,360,225	T181I		Het
Ighv1-66	C	A	12: 115,593,412	V17F	probably damaging	Het
Ighv5-12-4	A	G	12: 113,762,510	V31A	possibly damaging	Het
Ints12	T	A	3: 133,109,242	N403K	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kalrn	A	C	16: 34,227,126	N908K	probably benign	Het
Kctd9	G	A	14: 67,724,567	V20I	unknown	Het
Krt78	G	T	15: 101,953,311	L167M	probably damaging	Het
Ldb1	T	C	19: 46,034,855	E206G	probably damaging	Het
Lig1	A	G	7: 13,296,787	Y455C	probably damaging	Het
Ltbp1	T	G	17: 75,179,082	I34S	probably damaging	Het
Map2	T	C	1: 66,415,599	I1216T	possibly damaging	Het
Mex3c	T	C	18: 73,573,729	V229A	probably damaging	Het
Mfsd11	T	C	11: 116,854,700		probably null	Het
Mroh1	A	G	15: 76,447,274	T1233A	probably benign	Het
Myct1	C	T	10: 5,604,208	T25I	probably damaging	Het
Nipbl	A	T	15: 8,361,787	H234Q	probably damaging	Het
Npc1l1	G	A	11: 6,225,665	P549S	probably damaging	Het
Olfr102	A	T	17: 37,313,751	L211Q	probably damaging	Het
Olfr1264	A	G	2: 90,021,925	V47A	probably benign	Het
Olfr153	A	G	2: 87,532,843	D270G	possibly damaging	Het
Olfr190	A	T	16: 59,074,483	V199D	possibly damaging	Het
Olfr803	A	T	10: 129,691,503	Y179*	probably null	Het
Padi3	A	T	4: 140,796,484	C228*	probably null	Het
Palld	T	A	8: 61,533,478	D1015V	unknown	Het
Pcna-ps2	A	T	19: 9,284,124	Y249F	probably benign	Het
Pelo	C	T	13: 115,088,915	C258Y	probably benign	Het
Ppp1r13b	A	T	12: 111,836,996		probably benign	Het
Prdm2	A	G	4: 143,134,201	W840R	probably damaging	Het
Prkcg	A	G	7: 3,322,341	D428G	possibly damaging	Het
Pus7	G	A	5: 23,743,478	R571*	probably null	Het
Rab11fip3	A	G	17: 26,067,953	C409R	possibly damaging	Het
Rdh13	T	C	7: 4,431,523	D186G	probably damaging	Het
Rslcan18	T	A	13: 67,098,729	H273L	probably damaging	Het
Rxfp1	T	A	3: 79,651,982		probably benign	Het
Sh3bp1	T	A	15: 78,904,340		probably null	Het
Siglecg	T	A	7: 43,408,584	S9T	probably benign	Het
Slc9a1	T	C	4: 133,411,947	F159L	probably benign	Het
Slc9a2	A	G	1: 40,718,849	I183V	probably benign	Het
St6galnac4	A	G	2: 32,594,098	M103V	probably damaging	Het
Tbc1d30	T	C	10: 121,351,154	D42G	possibly damaging	Het
Tlr5	C	A	1: 182,973,767	T212K	probably benign	Het
Trim43b	T	G	9: 89,087,589	I269L	probably benign	Het
Ttll6	T	C	11: 96,156,666	L697P	possibly damaging	Het
Ttn	T	G	2: 76,718,895	T31813P	probably damaging	Het
Ttn	A	T	2: 76,741,588	D26320E	probably damaging	Het
Uba6	A	G	5: 86,159,202		probably null	Het
Usp1	C	G	4: 98,930,948	Q216E	probably benign	Het
Vcan	T	C	13: 89,704,907	T645A	probably benign	Het
Wdr64	C	A	1: 175,772,284	P559H	probably benign	Het
Zfat	T	C	15: 68,184,466	Y247C	probably damaging	Het
Zfp979	A	T	4: 147,613,762	N163K	probably damaging	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1969:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9612:Dnah9	UTSW	11	65927649	missense	probably benign	0.00
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAGTGAAGTTGTCCAGGGC -3'
(R):5'- CTCTAGGTAATGGAGCACTGC -3'

Sequencing Primer
(F):5'- AAGTTGTCCAGGGCTTTGTGTAAG -3'
(R):5'- TAATGGAGCACTGCTGACTC -3'

Posted On

2021-08-02