Incidental Mutation 'R8887:Dnah9'
ID 677419
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Name dynein, axonemal, heavy chain 9
Synonyms D11Ertd686e, Dnahc9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 65831282-66168551 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65855384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3968 (T3968A)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080665
AA Change: T3968A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: T3968A

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152386
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.1849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,033,354 A615S possibly damaging Het
Acsbg2 T C 17: 56,868,285 T76A probably benign Het
Actn1 A G 12: 80,168,423 C860R probably damaging Het
Adam23 T A 1: 63,515,585 L170Q probably damaging Het
Afdn C T 17: 13,896,139 R1620* probably null Het
Agfg1 A G 1: 82,870,804 probably benign Het
Aire A G 10: 78,034,464 S476P probably damaging Het
Arhgef26 A G 3: 62,339,980 T162A probably benign Het
Atp1a2 T C 1: 172,285,655 Q487R probably null Het
BC048507 T A 13: 67,863,509 C2S probably benign Het
Bnc2 A C 4: 84,291,470 probably benign Het
Bop1 C T 15: 76,454,324 G473R probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
Cacna1i T C 15: 80,374,693 V1201A possibly damaging Het
Cecr2 C A 6: 120,738,201 T249K probably damaging Het
Clca2 C A 3: 145,085,049 G421* probably null Het
Clec1b A T 6: 129,401,740 probably null Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Col15a1 A G 4: 47,287,091 Q843R probably damaging Het
Col6a3 T C 1: 90,828,226 S114G probably benign Het
Corin A T 5: 72,329,610 probably null Het
Cyp2u1 A G 3: 131,302,854 Y92H probably damaging Het
Dcbld2 T C 16: 58,408,907 L51P probably damaging Het
Dip2c T A 13: 9,623,953 probably benign Het
Dlc1 A T 8: 36,584,327 V299E probably benign Het
Dlgap2 G A 8: 14,179,682 probably null Het
Dnah1 A G 14: 31,311,040 L346P probably damaging Het
Duox2 A C 2: 122,289,563 M822R probably null Het
E2f7 A T 10: 110,774,813 Q433L probably benign Het
Eif3k A C 7: 28,980,476 Y42* probably null Het
Elmod3 A G 6: 72,586,511 S45P probably damaging Het
Emilin3 C A 2: 160,909,188 V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 F283L probably benign Het
Fbxw7 T C 3: 84,969,242 Y358H Het
G430095P16Rik A G 8: 84,726,414 N10S unknown Het
Gldc A G 19: 30,133,756 V540A possibly damaging Het
Gm13084 A G 4: 143,812,687 F79L probably damaging Het
Gm3667 T A 14: 6,874,222 E67D probably benign Het
Golga3 T A 5: 110,205,760 probably benign Het
H60c T C 10: 3,267,255 E38G probably benign Het
Hectd4 A G 5: 121,295,478 D952G probably benign Het
Hoxb8 T A 11: 96,284,397 L220Q probably damaging Het
Ice1 A T 13: 70,602,931 L1679M probably damaging Het
Ifi202b T A 1: 173,974,914 Y118F probably damaging Het
Ift122 A T 6: 115,891,919 T456S probably benign Het
Ighg3 G A 12: 113,360,225 T181I Het
Ighv1-66 C A 12: 115,593,412 V17F probably damaging Het
Ighv5-12-4 A G 12: 113,762,510 V31A possibly damaging Het
Ints12 T A 3: 133,109,242 N403K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kalrn A C 16: 34,227,126 N908K probably benign Het
Kctd9 G A 14: 67,724,567 V20I unknown Het
Krt78 G T 15: 101,953,311 L167M probably damaging Het
Ldb1 T C 19: 46,034,855 E206G probably damaging Het
Lig1 A G 7: 13,296,787 Y455C probably damaging Het
Ltbp1 T G 17: 75,179,082 I34S probably damaging Het
Map2 T C 1: 66,415,599 I1216T possibly damaging Het
Mex3c T C 18: 73,573,729 V229A probably damaging Het
Mfsd11 T C 11: 116,854,700 probably null Het
Mroh1 A G 15: 76,447,274 T1233A probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Nipbl A T 15: 8,361,787 H234Q probably damaging Het
Npc1l1 G A 11: 6,225,665 P549S probably damaging Het
Olfr102 A T 17: 37,313,751 L211Q probably damaging Het
Olfr1264 A G 2: 90,021,925 V47A probably benign Het
Olfr153 A G 2: 87,532,843 D270G possibly damaging Het
Olfr190 A T 16: 59,074,483 V199D possibly damaging Het
Olfr803 A T 10: 129,691,503 Y179* probably null Het
Padi3 A T 4: 140,796,484 C228* probably null Het
Palld T A 8: 61,533,478 D1015V unknown Het
Pcna-ps2 A T 19: 9,284,124 Y249F probably benign Het
Pelo C T 13: 115,088,915 C258Y probably benign Het
Ppp1r13b A T 12: 111,836,996 probably benign Het
Prdm2 A G 4: 143,134,201 W840R probably damaging Het
Prkcg A G 7: 3,322,341 D428G possibly damaging Het
Pus7 G A 5: 23,743,478 R571* probably null Het
Rab11fip3 A G 17: 26,067,953 C409R possibly damaging Het
Rdh13 T C 7: 4,431,523 D186G probably damaging Het
Rslcan18 T A 13: 67,098,729 H273L probably damaging Het
Rxfp1 T A 3: 79,651,982 probably benign Het
Sh3bp1 T A 15: 78,904,340 probably null Het
Siglecg T A 7: 43,408,584 S9T probably benign Het
Slc9a1 T C 4: 133,411,947 F159L probably benign Het
Slc9a2 A G 1: 40,718,849 I183V probably benign Het
St6galnac4 A G 2: 32,594,098 M103V probably damaging Het
Tbc1d30 T C 10: 121,351,154 D42G possibly damaging Het
Tlr5 C A 1: 182,973,767 T212K probably benign Het
Trim43b T G 9: 89,087,589 I269L probably benign Het
Ttll6 T C 11: 96,156,666 L697P possibly damaging Het
Ttn T G 2: 76,718,895 T31813P probably damaging Het
Ttn A T 2: 76,741,588 D26320E probably damaging Het
Uba6 A G 5: 86,159,202 probably null Het
Usp1 C G 4: 98,930,948 Q216E probably benign Het
Vcan T C 13: 89,704,907 T645A probably benign Het
Wdr64 C A 1: 175,772,284 P559H probably benign Het
Zfat T C 15: 68,184,466 Y247C probably damaging Het
Zfp979 A T 4: 147,613,762 N163K probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
Tweed UTSW 11 66072072 missense probably damaging 0.99
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 splice site probably null
R0974:Dnah9 UTSW 11 66005837 splice site probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
R7659:Dnah9 UTSW 11 65989780 missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66118958 missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65911830 missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65850013 missense probably damaging 1.00
R7808:Dnah9 UTSW 11 66005805 nonsense probably null
R7814:Dnah9 UTSW 11 66005660 missense probably damaging 1.00
R7818:Dnah9 UTSW 11 66025211 missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 66072072 missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65841401 missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 66017375 missense probably benign 0.02
R8232:Dnah9 UTSW 11 65855323 missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65989818 missense probably benign 0.00
R8326:Dnah9 UTSW 11 66117626 missense probably benign 0.01
R8338:Dnah9 UTSW 11 65841241 critical splice donor site probably null
R8356:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65831730 missense probably benign 0.00
R8721:Dnah9 UTSW 11 66095298 missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65927990 missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65905231 missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65859483 missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65849916 missense probably benign 0.13
R8837:Dnah9 UTSW 11 65855234 missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 66053014 missense probably damaging 1.00
R8921:Dnah9 UTSW 11 65911921 missense probably benign
R8933:Dnah9 UTSW 11 65855252 missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66168400 missense possibly damaging 0.91
R8967:Dnah9 UTSW 11 66125112 critical splice donor site probably null
R8979:Dnah9 UTSW 11 66005152 missense probably benign
R8991:Dnah9 UTSW 11 65886680 missense probably damaging 0.96
R9016:Dnah9 UTSW 11 66108030 missense probably damaging 0.99
R9025:Dnah9 UTSW 11 66005825 missense probably damaging 1.00
R9043:Dnah9 UTSW 11 65954854 missense
R9047:Dnah9 UTSW 11 66072099 missense possibly damaging 0.89
R9076:Dnah9 UTSW 11 66117638 missense probably benign 0.21
R9113:Dnah9 UTSW 11 65989887 missense probably damaging 1.00
R9152:Dnah9 UTSW 11 66130631 missense probably damaging 1.00
R9187:Dnah9 UTSW 11 66005146 missense probably benign
R9198:Dnah9 UTSW 11 65955744 missense probably benign 0.02
R9203:Dnah9 UTSW 11 65855287 missense possibly damaging 0.58
R9234:Dnah9 UTSW 11 66033925 missense possibly damaging 0.68
R9245:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R9265:Dnah9 UTSW 11 65841255 missense probably benign 0.01
R9307:Dnah9 UTSW 11 66085474 missense probably benign 0.14
R9336:Dnah9 UTSW 11 65870949 missense probably damaging 1.00
R9386:Dnah9 UTSW 11 65947542 missense probably damaging 1.00
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65895972 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65927853 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65970084 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66037474 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66072835 missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66126650 missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 66085174 missense probably benign
Z1186:Dnah9 UTSW 11 66147381 missense probably benign
Z1187:Dnah9 UTSW 11 66085174 missense probably benign
Z1187:Dnah9 UTSW 11 66147381 missense probably benign
Z1188:Dnah9 UTSW 11 66085174 missense probably benign
Z1188:Dnah9 UTSW 11 66147381 missense probably benign
Z1189:Dnah9 UTSW 11 66085174 missense probably benign
Z1189:Dnah9 UTSW 11 66147381 missense probably benign
Z1190:Dnah9 UTSW 11 66085174 missense probably benign
Z1190:Dnah9 UTSW 11 66147381 missense probably benign
Z1191:Dnah9 UTSW 11 66085174 missense probably benign
Z1191:Dnah9 UTSW 11 66147381 missense probably benign
Z1192:Dnah9 UTSW 11 66085174 missense probably benign
Z1192:Dnah9 UTSW 11 66147381 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGAAGTTGTCCAGGGC -3'
(R):5'- CTCTAGGTAATGGAGCACTGC -3'

Sequencing Primer
(F):5'- AAGTTGTCCAGGGCTTTGTGTAAG -3'
(R):5'- TAATGGAGCACTGCTGACTC -3'
Posted On 2021-08-02