Incidental Mutation 'R8887:Ice1'
ID 677429
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70602931 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 1679 (L1679M)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: L1679M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: L1679M

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,033,354 A615S possibly damaging Het
Acsbg2 T C 17: 56,868,285 T76A probably benign Het
Actn1 A G 12: 80,168,423 C860R probably damaging Het
Adam23 T A 1: 63,515,585 L170Q probably damaging Het
Afdn C T 17: 13,896,139 R1620* probably null Het
Agfg1 A G 1: 82,870,804 probably benign Het
Aire A G 10: 78,034,464 S476P probably damaging Het
Arhgef26 A G 3: 62,339,980 T162A probably benign Het
Atp1a2 T C 1: 172,285,655 Q487R probably null Het
BC048507 T A 13: 67,863,509 C2S probably benign Het
Bnc2 A C 4: 84,291,470 probably benign Het
Bop1 C T 15: 76,454,324 G473R probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
Cacna1i T C 15: 80,374,693 V1201A possibly damaging Het
Cecr2 C A 6: 120,738,201 T249K probably damaging Het
Clca2 C A 3: 145,085,049 G421* probably null Het
Clec1b A T 6: 129,401,740 probably null Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Col15a1 A G 4: 47,287,091 Q843R probably damaging Het
Col6a3 T C 1: 90,828,226 S114G probably benign Het
Corin A T 5: 72,329,610 probably null Het
Cyp2u1 A G 3: 131,302,854 Y92H probably damaging Het
Dcbld2 T C 16: 58,408,907 L51P probably damaging Het
Dip2c T A 13: 9,623,953 probably benign Het
Dlc1 A T 8: 36,584,327 V299E probably benign Het
Dlgap2 G A 8: 14,179,682 probably null Het
Dnah1 A G 14: 31,311,040 L346P probably damaging Het
Dnah9 T C 11: 65,855,384 T3968A probably benign Het
Duox2 A C 2: 122,289,563 M822R probably null Het
E2f7 A T 10: 110,774,813 Q433L probably benign Het
Eif3k A C 7: 28,980,476 Y42* probably null Het
Elmod3 A G 6: 72,586,511 S45P probably damaging Het
Emilin3 C A 2: 160,909,188 V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 F283L probably benign Het
Fbxw7 T C 3: 84,969,242 Y358H Het
G430095P16Rik A G 8: 84,726,414 N10S unknown Het
Gldc A G 19: 30,133,756 V540A possibly damaging Het
Gm13084 A G 4: 143,812,687 F79L probably damaging Het
Gm3667 T A 14: 6,874,222 E67D probably benign Het
Golga3 T A 5: 110,205,760 probably benign Het
H60c T C 10: 3,267,255 E38G probably benign Het
Hectd4 A G 5: 121,295,478 D952G probably benign Het
Hoxb8 T A 11: 96,284,397 L220Q probably damaging Het
Ifi202b T A 1: 173,974,914 Y118F probably damaging Het
Ift122 A T 6: 115,891,919 T456S probably benign Het
Ighg3 G A 12: 113,360,225 T181I Het
Ighv1-66 C A 12: 115,593,412 V17F probably damaging Het
Ighv5-12-4 A G 12: 113,762,510 V31A possibly damaging Het
Ints12 T A 3: 133,109,242 N403K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kalrn A C 16: 34,227,126 N908K probably benign Het
Kctd9 G A 14: 67,724,567 V20I unknown Het
Krt78 G T 15: 101,953,311 L167M probably damaging Het
Ldb1 T C 19: 46,034,855 E206G probably damaging Het
Lig1 A G 7: 13,296,787 Y455C probably damaging Het
Ltbp1 T G 17: 75,179,082 I34S probably damaging Het
Map2 T C 1: 66,415,599 I1216T possibly damaging Het
Mex3c T C 18: 73,573,729 V229A probably damaging Het
Mfsd11 T C 11: 116,854,700 probably null Het
Mroh1 A G 15: 76,447,274 T1233A probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Nipbl A T 15: 8,361,787 H234Q probably damaging Het
Npc1l1 G A 11: 6,225,665 P549S probably damaging Het
Olfr102 A T 17: 37,313,751 L211Q probably damaging Het
Olfr1264 A G 2: 90,021,925 V47A probably benign Het
Olfr153 A G 2: 87,532,843 D270G possibly damaging Het
Olfr190 A T 16: 59,074,483 V199D possibly damaging Het
Olfr803 A T 10: 129,691,503 Y179* probably null Het
Padi3 A T 4: 140,796,484 C228* probably null Het
Palld T A 8: 61,533,478 D1015V unknown Het
Pcna-ps2 A T 19: 9,284,124 Y249F probably benign Het
Pelo C T 13: 115,088,915 C258Y probably benign Het
Ppp1r13b A T 12: 111,836,996 probably benign Het
Prdm2 A G 4: 143,134,201 W840R probably damaging Het
Prkcg A G 7: 3,322,341 D428G possibly damaging Het
Pus7 G A 5: 23,743,478 R571* probably null Het
Rab11fip3 A G 17: 26,067,953 C409R possibly damaging Het
Rdh13 T C 7: 4,431,523 D186G probably damaging Het
Rslcan18 T A 13: 67,098,729 H273L probably damaging Het
Rxfp1 T A 3: 79,651,982 probably benign Het
Sh3bp1 T A 15: 78,904,340 probably null Het
Siglecg T A 7: 43,408,584 S9T probably benign Het
Slc9a1 T C 4: 133,411,947 F159L probably benign Het
Slc9a2 A G 1: 40,718,849 I183V probably benign Het
St6galnac4 A G 2: 32,594,098 M103V probably damaging Het
Tbc1d30 T C 10: 121,351,154 D42G possibly damaging Het
Tlr5 C A 1: 182,973,767 T212K probably benign Het
Trim43b T G 9: 89,087,589 I269L probably benign Het
Ttll6 T C 11: 96,156,666 L697P possibly damaging Het
Ttn T G 2: 76,718,895 T31813P probably damaging Het
Ttn A T 2: 76,741,588 D26320E probably damaging Het
Uba6 A G 5: 86,159,202 probably null Het
Usp1 C G 4: 98,930,948 Q216E probably benign Het
Vcan T C 13: 89,704,907 T645A probably benign Het
Wdr64 C A 1: 175,772,284 P559H probably benign Het
Zfat T C 15: 68,184,466 Y247C probably damaging Het
Zfp979 A T 4: 147,613,762 N163K probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70594894 missense probably damaging 1.00
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGCATGTTCCCTTTGAGG -3'
(R):5'- TCCAAGGTCATCACAGACACTG -3'

Sequencing Primer
(F):5'- CCCTTTGAGGAGGCTGAGG -3'
(R):5'- GGTCATCACAGACACTGTCTCC -3'
Posted On 2021-08-02