Incidental Mutation 'R8887:Nipbl'
ID 677435
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8361787 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 234 (H234Q)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000052965
AA Change: H234Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: H234Q

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,033,354 A615S possibly damaging Het
Acsbg2 T C 17: 56,868,285 T76A probably benign Het
Actn1 A G 12: 80,168,423 C860R probably damaging Het
Adam23 T A 1: 63,515,585 L170Q probably damaging Het
Afdn C T 17: 13,896,139 R1620* probably null Het
Agfg1 A G 1: 82,870,804 probably benign Het
Aire A G 10: 78,034,464 S476P probably damaging Het
Arhgef26 A G 3: 62,339,980 T162A probably benign Het
Atp1a2 T C 1: 172,285,655 Q487R probably null Het
BC048507 T A 13: 67,863,509 C2S probably benign Het
Bnc2 A C 4: 84,291,470 probably benign Het
Bop1 C T 15: 76,454,324 G473R probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
Cacna1i T C 15: 80,374,693 V1201A possibly damaging Het
Cecr2 C A 6: 120,738,201 T249K probably damaging Het
Clca2 C A 3: 145,085,049 G421* probably null Het
Clec1b A T 6: 129,401,740 probably null Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Col15a1 A G 4: 47,287,091 Q843R probably damaging Het
Col6a3 T C 1: 90,828,226 S114G probably benign Het
Corin A T 5: 72,329,610 probably null Het
Cyp2u1 A G 3: 131,302,854 Y92H probably damaging Het
Dcbld2 T C 16: 58,408,907 L51P probably damaging Het
Dip2c T A 13: 9,623,953 probably benign Het
Dlc1 A T 8: 36,584,327 V299E probably benign Het
Dlgap2 G A 8: 14,179,682 probably null Het
Dnah1 A G 14: 31,311,040 L346P probably damaging Het
Dnah9 T C 11: 65,855,384 T3968A probably benign Het
Duox2 A C 2: 122,289,563 M822R probably null Het
E2f7 A T 10: 110,774,813 Q433L probably benign Het
Eif3k A C 7: 28,980,476 Y42* probably null Het
Elmod3 A G 6: 72,586,511 S45P probably damaging Het
Emilin3 C A 2: 160,909,188 V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 F283L probably benign Het
Fbxw7 T C 3: 84,969,242 Y358H Het
G430095P16Rik A G 8: 84,726,414 N10S unknown Het
Gldc A G 19: 30,133,756 V540A possibly damaging Het
Gm13084 A G 4: 143,812,687 F79L probably damaging Het
Gm3667 T A 14: 6,874,222 E67D probably benign Het
Golga3 T A 5: 110,205,760 probably benign Het
H60c T C 10: 3,267,255 E38G probably benign Het
Hectd4 A G 5: 121,295,478 D952G probably benign Het
Hoxb8 T A 11: 96,284,397 L220Q probably damaging Het
Ice1 A T 13: 70,602,931 L1679M probably damaging Het
Ifi202b T A 1: 173,974,914 Y118F probably damaging Het
Ift122 A T 6: 115,891,919 T456S probably benign Het
Ighg3 G A 12: 113,360,225 T181I Het
Ighv1-66 C A 12: 115,593,412 V17F probably damaging Het
Ighv5-12-4 A G 12: 113,762,510 V31A possibly damaging Het
Ints12 T A 3: 133,109,242 N403K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kalrn A C 16: 34,227,126 N908K probably benign Het
Kctd9 G A 14: 67,724,567 V20I unknown Het
Krt78 G T 15: 101,953,311 L167M probably damaging Het
Ldb1 T C 19: 46,034,855 E206G probably damaging Het
Lig1 A G 7: 13,296,787 Y455C probably damaging Het
Ltbp1 T G 17: 75,179,082 I34S probably damaging Het
Map2 T C 1: 66,415,599 I1216T possibly damaging Het
Mex3c T C 18: 73,573,729 V229A probably damaging Het
Mfsd11 T C 11: 116,854,700 probably null Het
Mroh1 A G 15: 76,447,274 T1233A probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Npc1l1 G A 11: 6,225,665 P549S probably damaging Het
Olfr102 A T 17: 37,313,751 L211Q probably damaging Het
Olfr1264 A G 2: 90,021,925 V47A probably benign Het
Olfr153 A G 2: 87,532,843 D270G possibly damaging Het
Olfr190 A T 16: 59,074,483 V199D possibly damaging Het
Olfr803 A T 10: 129,691,503 Y179* probably null Het
Padi3 A T 4: 140,796,484 C228* probably null Het
Palld T A 8: 61,533,478 D1015V unknown Het
Pcna-ps2 A T 19: 9,284,124 Y249F probably benign Het
Pelo C T 13: 115,088,915 C258Y probably benign Het
Ppp1r13b A T 12: 111,836,996 probably benign Het
Prdm2 A G 4: 143,134,201 W840R probably damaging Het
Prkcg A G 7: 3,322,341 D428G possibly damaging Het
Pus7 G A 5: 23,743,478 R571* probably null Het
Rab11fip3 A G 17: 26,067,953 C409R possibly damaging Het
Rdh13 T C 7: 4,431,523 D186G probably damaging Het
Rslcan18 T A 13: 67,098,729 H273L probably damaging Het
Rxfp1 T A 3: 79,651,982 probably benign Het
Sh3bp1 T A 15: 78,904,340 probably null Het
Siglecg T A 7: 43,408,584 S9T probably benign Het
Slc9a1 T C 4: 133,411,947 F159L probably benign Het
Slc9a2 A G 1: 40,718,849 I183V probably benign Het
St6galnac4 A G 2: 32,594,098 M103V probably damaging Het
Tbc1d30 T C 10: 121,351,154 D42G possibly damaging Het
Tlr5 C A 1: 182,973,767 T212K probably benign Het
Trim43b T G 9: 89,087,589 I269L probably benign Het
Ttll6 T C 11: 96,156,666 L697P possibly damaging Het
Ttn T G 2: 76,718,895 T31813P probably damaging Het
Ttn A T 2: 76,741,588 D26320E probably damaging Het
Uba6 A G 5: 86,159,202 probably null Het
Usp1 C G 4: 98,930,948 Q216E probably benign Het
Vcan T C 13: 89,704,907 T645A probably benign Het
Wdr64 C A 1: 175,772,284 P559H probably benign Het
Zfat T C 15: 68,184,466 Y247C probably damaging Het
Zfp979 A T 4: 147,613,762 N163K probably damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R3620_nipbl_616 UTSW 15 8333024 missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6296:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
R8854:Nipbl UTSW 15 8300726 missense probably damaging 1.00
R8942:Nipbl UTSW 15 8351620 missense probably benign
R8991:Nipbl UTSW 15 8291513 missense probably damaging 1.00
R9008:Nipbl UTSW 15 8327124 missense probably damaging 1.00
R9070:Nipbl UTSW 15 8338731 missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8350856 missense probably benign 0.00
R9622:Nipbl UTSW 15 8336889 missense probably benign 0.27
R9778:Nipbl UTSW 15 8291548 missense probably benign 0.10
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAGATGTGGTGTTCATACC -3'
(R):5'- TGACATCCATCACAGTATCGGG -3'

Sequencing Primer
(F):5'- AGATGTGGTGTTCATACCTAGATTC -3'
(R):5'- GACATCCATCACAGTATCGGGATTTG -3'
Posted On 2021-08-02