Incidental Mutation 'R8887:Kalrn'
ID 677442
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Name kalirin, RhoGEF kinase
Synonyms 2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.942) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 33969073-34573532 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 34227126 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 908 (N908K)
Ref Sequence ENSEMBL: ENSMUSP00000110611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000076810
AA Change: N890K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: N890K

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089655
AA Change: N908K

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: N908K

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: N254K

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114949
AA Change: N267K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: N267K

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114953
AA Change: N267K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: N267K

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114954
AA Change: N267K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: N267K

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114960
AA Change: N908K

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: N908K

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: N885K

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151491
AA Change: N655K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: N655K

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,033,354 A615S possibly damaging Het
Acsbg2 T C 17: 56,868,285 T76A probably benign Het
Actn1 A G 12: 80,168,423 C860R probably damaging Het
Adam23 T A 1: 63,515,585 L170Q probably damaging Het
Afdn C T 17: 13,896,139 R1620* probably null Het
Agfg1 A G 1: 82,870,804 probably benign Het
Aire A G 10: 78,034,464 S476P probably damaging Het
Arhgef26 A G 3: 62,339,980 T162A probably benign Het
Atp1a2 T C 1: 172,285,655 Q487R probably null Het
BC048507 T A 13: 67,863,509 C2S probably benign Het
Bnc2 A C 4: 84,291,470 probably benign Het
Bop1 C T 15: 76,454,324 G473R probably damaging Het
C1galt1 A G 6: 7,866,379 E75G probably benign Het
Cacna1i T C 15: 80,374,693 V1201A possibly damaging Het
Cecr2 C A 6: 120,738,201 T249K probably damaging Het
Clca2 C A 3: 145,085,049 G421* probably null Het
Clec1b A T 6: 129,401,740 probably null Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Col15a1 A G 4: 47,287,091 Q843R probably damaging Het
Col6a3 T C 1: 90,828,226 S114G probably benign Het
Corin A T 5: 72,329,610 probably null Het
Cyp2u1 A G 3: 131,302,854 Y92H probably damaging Het
Dcbld2 T C 16: 58,408,907 L51P probably damaging Het
Dip2c T A 13: 9,623,953 probably benign Het
Dlc1 A T 8: 36,584,327 V299E probably benign Het
Dlgap2 G A 8: 14,179,682 probably null Het
Dnah1 A G 14: 31,311,040 L346P probably damaging Het
Dnah9 T C 11: 65,855,384 T3968A probably benign Het
Duox2 A C 2: 122,289,563 M822R probably null Het
E2f7 A T 10: 110,774,813 Q433L probably benign Het
Eif3k A C 7: 28,980,476 Y42* probably null Het
Elmod3 A G 6: 72,586,511 S45P probably damaging Het
Emilin3 C A 2: 160,909,188 V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 F283L probably benign Het
Fbxw7 T C 3: 84,969,242 Y358H Het
G430095P16Rik A G 8: 84,726,414 N10S unknown Het
Gldc A G 19: 30,133,756 V540A possibly damaging Het
Gm13084 A G 4: 143,812,687 F79L probably damaging Het
Gm3667 T A 14: 6,874,222 E67D probably benign Het
Golga3 T A 5: 110,205,760 probably benign Het
H60c T C 10: 3,267,255 E38G probably benign Het
Hectd4 A G 5: 121,295,478 D952G probably benign Het
Hoxb8 T A 11: 96,284,397 L220Q probably damaging Het
Ice1 A T 13: 70,602,931 L1679M probably damaging Het
Ifi202b T A 1: 173,974,914 Y118F probably damaging Het
Ift122 A T 6: 115,891,919 T456S probably benign Het
Ighg3 G A 12: 113,360,225 T181I Het
Ighv1-66 C A 12: 115,593,412 V17F probably damaging Het
Ighv5-12-4 A G 12: 113,762,510 V31A possibly damaging Het
Ints12 T A 3: 133,109,242 N403K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kctd9 G A 14: 67,724,567 V20I unknown Het
Krt78 G T 15: 101,953,311 L167M probably damaging Het
Ldb1 T C 19: 46,034,855 E206G probably damaging Het
Lig1 A G 7: 13,296,787 Y455C probably damaging Het
Ltbp1 T G 17: 75,179,082 I34S probably damaging Het
Map2 T C 1: 66,415,599 I1216T possibly damaging Het
Mex3c T C 18: 73,573,729 V229A probably damaging Het
Mfsd11 T C 11: 116,854,700 probably null Het
Mroh1 A G 15: 76,447,274 T1233A probably benign Het
Myct1 C T 10: 5,604,208 T25I probably damaging Het
Nipbl A T 15: 8,361,787 H234Q probably damaging Het
Npc1l1 G A 11: 6,225,665 P549S probably damaging Het
Olfr102 A T 17: 37,313,751 L211Q probably damaging Het
Olfr1264 A G 2: 90,021,925 V47A probably benign Het
Olfr153 A G 2: 87,532,843 D270G possibly damaging Het
Olfr190 A T 16: 59,074,483 V199D possibly damaging Het
Olfr803 A T 10: 129,691,503 Y179* probably null Het
Padi3 A T 4: 140,796,484 C228* probably null Het
Palld T A 8: 61,533,478 D1015V unknown Het
Pcna-ps2 A T 19: 9,284,124 Y249F probably benign Het
Pelo C T 13: 115,088,915 C258Y probably benign Het
Ppp1r13b A T 12: 111,836,996 probably benign Het
Prdm2 A G 4: 143,134,201 W840R probably damaging Het
Prkcg A G 7: 3,322,341 D428G possibly damaging Het
Pus7 G A 5: 23,743,478 R571* probably null Het
Rab11fip3 A G 17: 26,067,953 C409R possibly damaging Het
Rdh13 T C 7: 4,431,523 D186G probably damaging Het
Rslcan18 T A 13: 67,098,729 H273L probably damaging Het
Rxfp1 T A 3: 79,651,982 probably benign Het
Sh3bp1 T A 15: 78,904,340 probably null Het
Siglecg T A 7: 43,408,584 S9T probably benign Het
Slc9a1 T C 4: 133,411,947 F159L probably benign Het
Slc9a2 A G 1: 40,718,849 I183V probably benign Het
St6galnac4 A G 2: 32,594,098 M103V probably damaging Het
Tbc1d30 T C 10: 121,351,154 D42G possibly damaging Het
Tlr5 C A 1: 182,973,767 T212K probably benign Het
Trim43b T G 9: 89,087,589 I269L probably benign Het
Ttll6 T C 11: 96,156,666 L697P possibly damaging Het
Ttn T G 2: 76,718,895 T31813P probably damaging Het
Ttn A T 2: 76,741,588 D26320E probably damaging Het
Uba6 A G 5: 86,159,202 probably null Het
Usp1 C G 4: 98,930,948 Q216E probably benign Het
Vcan T C 13: 89,704,907 T645A probably benign Het
Wdr64 C A 1: 175,772,284 P559H probably benign Het
Zfat T C 15: 68,184,466 Y247C probably damaging Het
Zfp979 A T 4: 147,613,762 N163K probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
ethereal UTSW 16 33975435 utr 3 prime probably benign
Hidden UTSW 16 34027976 missense probably damaging 1.00
Soulful UTSW 16 34187484 nonsense probably null
G1Funyon:Kalrn UTSW 16 34357100 missense probably benign 0.05
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 splice site probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6128:Kalrn UTSW 16 34212885 missense probably damaging 0.99
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
R7772:Kalrn UTSW 16 34031582 missense probably benign 0.04
R7796:Kalrn UTSW 16 34187484 nonsense probably null
R7867:Kalrn UTSW 16 33989791 missense possibly damaging 0.94
R7869:Kalrn UTSW 16 33988847 missense probably damaging 0.98
R7914:Kalrn UTSW 16 34028752 missense probably benign
R8080:Kalrn UTSW 16 33975668 missense possibly damaging 0.83
R8147:Kalrn UTSW 16 34055044 missense probably benign
R8239:Kalrn UTSW 16 34049783 missense noncoding transcript
R8281:Kalrn UTSW 16 34035061 nonsense probably null
R8294:Kalrn UTSW 16 34033584 missense probably benign 0.12
R8301:Kalrn UTSW 16 34357100 missense probably benign 0.05
R8686:Kalrn UTSW 16 34360935 missense probably damaging 1.00
R8693:Kalrn UTSW 16 34034514 missense probably damaging 1.00
R8798:Kalrn UTSW 16 33982855 missense possibly damaging 0.65
R8878:Kalrn UTSW 16 34198460 missense probably benign 0.05
R8878:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R8880:Kalrn UTSW 16 34217935 missense probably damaging 1.00
R8883:Kalrn UTSW 16 33993655 missense probably damaging 1.00
R9048:Kalrn UTSW 16 34034484 missense possibly damaging 0.84
R9111:Kalrn UTSW 16 34361001 missense probably damaging 0.96
R9317:Kalrn UTSW 16 34013675 missense
R9424:Kalrn UTSW 16 33988818 missense probably benign 0.06
R9442:Kalrn UTSW 16 34095879 start codon destroyed probably null 0.56
R9445:Kalrn UTSW 16 33985230 missense probably benign 0.13
R9515:Kalrn UTSW 16 34034494 missense probably damaging 1.00
R9516:Kalrn UTSW 16 34034494 missense probably damaging 1.00
RF014:Kalrn UTSW 16 34039933 missense probably benign 0.01
Z1177:Kalrn UTSW 16 34035506 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTCGAAAGCACAAGG -3'
(R):5'- GCCTTATGACAACAAATACAGGG -3'

Sequencing Primer
(F):5'- CCAAGGGAACGCTGACATCTG -3'
(R):5'- GAGACTGGGAAGGTGGCGC -3'
Posted On 2021-08-02