Incidental Mutation 'R8887:Or5h22'
ID 677444
Institutional Source Beutler Lab
Gene Symbol Or5h22
Ensembl Gene ENSMUSG00000064006
Gene Name olfactory receptor family 5 subfamily H member 22
Synonyms GA_x54KRFPKG5P-55303207-55302284, Olfr190, MOR183-4
MMRRC Submission 068752-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 58894518-58895441 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 58894846 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 199 (V199D)
Ref Sequence ENSEMBL: ENSMUSP00000148991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071243] [ENSMUST00000215687] [ENSMUST00000216495]
AlphaFold K7N5T5
Predicted Effect possibly damaging
Transcript: ENSMUST00000071243
AA Change: V199D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071224
Gene: ENSMUSG00000064006
AA Change: V199D

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-46 PFAM
Pfam:7tm_1 39 288 2.8e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215687
AA Change: V199D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216495
AA Change: V199D

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,175,285 (GRCm39) T76A probably benign Het
Actn1 A G 12: 80,215,197 (GRCm39) C860R probably damaging Het
Adam23 T A 1: 63,554,744 (GRCm39) L170Q probably damaging Het
Afdn C T 17: 14,116,401 (GRCm39) R1620* probably null Het
Agfg1 A G 1: 82,848,525 (GRCm39) probably benign Het
Aire A G 10: 77,870,298 (GRCm39) S476P probably damaging Het
Arhgef26 A G 3: 62,247,401 (GRCm39) T162A probably benign Het
Atp1a2 T C 1: 172,113,222 (GRCm39) Q487R probably null Het
BC048507 T A 13: 68,011,628 (GRCm39) C2S probably benign Het
Bltp1 G T 3: 37,087,503 (GRCm39) A615S possibly damaging Het
Bnc2 A C 4: 84,209,707 (GRCm39) probably benign Het
Bop1 C T 15: 76,338,524 (GRCm39) G473R probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
Cacna1i T C 15: 80,258,894 (GRCm39) V1201A possibly damaging Het
Cecr2 C A 6: 120,715,162 (GRCm39) T249K probably damaging Het
Clca3a2 C A 3: 144,790,810 (GRCm39) G421* probably null Het
Clec1b A T 6: 129,378,703 (GRCm39) probably null Het
Cnksr3 C T 10: 7,104,467 (GRCm39) D79N probably damaging Het
Col15a1 A G 4: 47,287,091 (GRCm39) Q843R probably damaging Het
Col6a3 T C 1: 90,755,948 (GRCm39) S114G probably benign Het
Corin A T 5: 72,486,953 (GRCm39) probably null Het
Cyp2u1 A G 3: 131,096,503 (GRCm39) Y92H probably damaging Het
Dcbld2 T C 16: 58,229,270 (GRCm39) L51P probably damaging Het
Dip2c T A 13: 9,673,989 (GRCm39) probably benign Het
Dlc1 A T 8: 37,051,481 (GRCm39) V299E probably benign Het
Dlgap2 G A 8: 14,229,682 (GRCm39) probably null Het
Dnah1 A G 14: 31,032,997 (GRCm39) L346P probably damaging Het
Dnah9 T C 11: 65,746,210 (GRCm39) T3968A probably benign Het
Duox2 A C 2: 122,120,044 (GRCm39) M822R probably null Het
E2f7 A T 10: 110,610,674 (GRCm39) Q433L probably benign Het
Eif3k A C 7: 28,679,901 (GRCm39) Y42* probably null Het
Elmod3 A G 6: 72,563,494 (GRCm39) S45P probably damaging Het
Emilin3 C A 2: 160,751,108 (GRCm39) V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 (GRCm39) F283L probably benign Het
Fbxw7 T C 3: 84,876,549 (GRCm39) Y358H Het
G430095P16Rik A G 8: 85,453,043 (GRCm39) N10S unknown Het
Gldc A G 19: 30,111,156 (GRCm39) V540A possibly damaging Het
Gm3667 T A 14: 18,271,553 (GRCm39) E67D probably benign Het
Golga3 T A 5: 110,353,626 (GRCm39) probably benign Het
H60c T C 10: 3,217,255 (GRCm39) E38G probably benign Het
Hectd4 A G 5: 121,433,541 (GRCm39) D952G probably benign Het
Hoxb8 T A 11: 96,175,223 (GRCm39) L220Q probably damaging Het
Ice1 A T 13: 70,751,050 (GRCm39) L1679M probably damaging Het
Ifi202b T A 1: 173,802,480 (GRCm39) Y118F probably damaging Het
Ift122 A T 6: 115,868,880 (GRCm39) T456S probably benign Het
Ighg3 G A 12: 113,323,845 (GRCm39) T181I Het
Ighv1-66 C A 12: 115,557,032 (GRCm39) V17F probably damaging Het
Ighv5-12-4 A G 12: 113,726,130 (GRCm39) V31A possibly damaging Het
Ints12 T A 3: 132,815,003 (GRCm39) N403K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kalrn A C 16: 34,047,496 (GRCm39) N908K probably benign Het
Kctd9 G A 14: 67,962,016 (GRCm39) V20I unknown Het
Krt78 G T 15: 101,861,746 (GRCm39) L167M probably damaging Het
Ldb1 T C 19: 46,023,294 (GRCm39) E206G probably damaging Het
Lig1 A G 7: 13,030,713 (GRCm39) Y455C probably damaging Het
Ltbp1 T G 17: 75,486,077 (GRCm39) I34S probably damaging Het
Map2 T C 1: 66,454,758 (GRCm39) I1216T possibly damaging Het
Mex3c T C 18: 73,706,800 (GRCm39) V229A probably damaging Het
Mfsd11 T C 11: 116,745,526 (GRCm39) probably null Het
Mroh1 A G 15: 76,331,474 (GRCm39) T1233A probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nipbl A T 15: 8,391,271 (GRCm39) H234Q probably damaging Het
Npc1l1 G A 11: 6,175,665 (GRCm39) P549S probably damaging Het
Or12d2 A T 17: 37,624,642 (GRCm39) L211Q probably damaging Het
Or4c3 A G 2: 89,852,269 (GRCm39) V47A probably benign Het
Or5w22 A G 2: 87,363,187 (GRCm39) D270G possibly damaging Het
Or6c3b A T 10: 129,527,372 (GRCm39) Y179* probably null Het
Padi3 A T 4: 140,523,795 (GRCm39) C228* probably null Het
Palld T A 8: 61,986,512 (GRCm39) D1015V unknown Het
Pcna-ps2 A T 19: 9,261,488 (GRCm39) Y249F probably benign Het
Pelo C T 13: 115,225,451 (GRCm39) C258Y probably benign Het
Ppp1r13b A T 12: 111,803,430 (GRCm39) probably benign Het
Pramel26 A G 4: 143,539,257 (GRCm39) F79L probably damaging Het
Prdm2 A G 4: 142,860,771 (GRCm39) W840R probably damaging Het
Prkcg A G 7: 3,370,857 (GRCm39) D428G possibly damaging Het
Pus7 G A 5: 23,948,476 (GRCm39) R571* probably null Het
Rab11fip3 A G 17: 26,286,927 (GRCm39) C409R possibly damaging Het
Rdh13 T C 7: 4,434,522 (GRCm39) D186G probably damaging Het
Rslcan18 T A 13: 67,246,793 (GRCm39) H273L probably damaging Het
Rxfp1 T A 3: 79,559,289 (GRCm39) probably benign Het
Sh3bp1 T A 15: 78,788,540 (GRCm39) probably null Het
Siglecg T A 7: 43,058,008 (GRCm39) S9T probably benign Het
Slc9a1 T C 4: 133,139,258 (GRCm39) F159L probably benign Het
Slc9a2 A G 1: 40,758,009 (GRCm39) I183V probably benign Het
St6galnac4 A G 2: 32,484,110 (GRCm39) M103V probably damaging Het
Tbc1d30 T C 10: 121,187,059 (GRCm39) D42G possibly damaging Het
Tlr5 C A 1: 182,801,332 (GRCm39) T212K probably benign Het
Trim43b T G 9: 88,969,642 (GRCm39) I269L probably benign Het
Ttll6 T C 11: 96,047,492 (GRCm39) L697P possibly damaging Het
Ttn T G 2: 76,549,239 (GRCm39) T31813P probably damaging Het
Ttn A T 2: 76,571,932 (GRCm39) D26320E probably damaging Het
Uba6 A G 5: 86,307,061 (GRCm39) probably null Het
Usp1 C G 4: 98,819,185 (GRCm39) Q216E probably benign Het
Vcan T C 13: 89,853,026 (GRCm39) T645A probably benign Het
Wdr64 C A 1: 175,599,850 (GRCm39) P559H probably benign Het
Zfat T C 15: 68,056,315 (GRCm39) Y247C probably damaging Het
Zfp979 A T 4: 147,698,219 (GRCm39) N163K probably damaging Het
Other mutations in Or5h22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Or5h22 APN 16 58,895,052 (GRCm39) nonsense probably null
IGL01011:Or5h22 APN 16 58,894,793 (GRCm39) missense probably benign 0.10
IGL01453:Or5h22 APN 16 58,895,132 (GRCm39) missense probably benign 0.00
IGL01978:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02348:Or5h22 APN 16 58,895,312 (GRCm39) missense probably damaging 0.99
IGL02423:Or5h22 APN 16 58,894,630 (GRCm39) missense probably benign 0.33
IGL02628:Or5h22 APN 16 58,895,155 (GRCm39) missense probably benign 0.01
R0220:Or5h22 UTSW 16 58,895,095 (GRCm39) missense probably damaging 1.00
R0471:Or5h22 UTSW 16 58,894,633 (GRCm39) missense probably benign 0.01
R1697:Or5h22 UTSW 16 58,895,270 (GRCm39) missense probably damaging 1.00
R3009:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3011:Or5h22 UTSW 16 58,895,350 (GRCm39) missense probably benign 0.01
R3027:Or5h22 UTSW 16 58,895,330 (GRCm39) missense probably benign 0.00
R4080:Or5h22 UTSW 16 58,894,619 (GRCm39) missense probably damaging 0.96
R4482:Or5h22 UTSW 16 58,895,286 (GRCm39) missense probably benign 0.02
R4895:Or5h22 UTSW 16 58,895,020 (GRCm39) missense probably benign 0.09
R5409:Or5h22 UTSW 16 58,894,559 (GRCm39) missense possibly damaging 0.94
R5825:Or5h22 UTSW 16 58,895,024 (GRCm39) missense probably benign 0.01
R6146:Or5h22 UTSW 16 58,895,077 (GRCm39) missense probably benign 0.05
R6249:Or5h22 UTSW 16 58,894,795 (GRCm39) missense probably damaging 1.00
R6996:Or5h22 UTSW 16 58,894,555 (GRCm39) missense probably benign 0.00
R7283:Or5h22 UTSW 16 58,894,555 (GRCm39) missense probably benign
R7707:Or5h22 UTSW 16 58,894,634 (GRCm39) missense possibly damaging 0.52
R8381:Or5h22 UTSW 16 58,895,225 (GRCm39) missense probably damaging 1.00
R8507:Or5h22 UTSW 16 58,895,243 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATCTGCTTCTTGGGACACG -3'
(R):5'- CGCTATGTAGCCATATGCAAACC -3'

Sequencing Primer
(F):5'- CTTCTTGGGACACGGGGAAAATATAC -3'
(R):5'- TGTAGCCATATGCAAACCTTTAC -3'
Posted On 2021-08-02