Incidental Mutation 'R8887:Rab11fip3'
ID 677446
Institutional Source Beutler Lab
Gene Symbol Rab11fip3
Ensembl Gene ENSMUSG00000037098
Gene Name RAB11 family interacting protein 3 (class II)
Synonyms D030060O14Rik, Rab11-FIP3
MMRRC Submission 068752-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 26208010-26288529 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26286927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 409 (C409R)
Ref Sequence ENSEMBL: ENSMUSP00000113521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120691] [ENSMUST00000122103]
AlphaFold Q8CHD8
Predicted Effect possibly damaging
Transcript: ENSMUST00000120691
AA Change: C409R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112875
Gene: ENSMUSG00000037098
AA Change: C409R

DomainStartEndE-ValueType
internal_repeat_1 29 130 3.12e-31 PROSPERO
internal_repeat_1 144 294 3.12e-31 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 916 936 N/A INTRINSIC
Blast:BRLZ 938 988 2e-11 BLAST
Pfam:RBD-FIP 1007 1047 4.7e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122103
AA Change: C409R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113521
Gene: ENSMUSG00000037098
AA Change: C409R

DomainStartEndE-ValueType
internal_repeat_1 29 130 2.03e-32 PROSPERO
internal_repeat_1 144 294 2.03e-32 PROSPERO
EFh 500 528 3.03e-1 SMART
EFh 532 560 3.86e1 SMART
low complexity region 784 796 N/A INTRINSIC
low complexity region 961 981 N/A INTRINSIC
Blast:BRLZ 983 1033 2e-11 BLAST
Pfam:RBD-FIP 1052 1092 4.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the large Rab GTPase family (see RAB1A; MIM 179508) have regulatory roles in the formation, targeting, and fusion of intracellular transport vesicles. RAB11FIP3 is one of many proteins that interact with and regulate Rab GTPases (Hales et al., 2001 [PubMed 11495908]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,175,285 (GRCm39) T76A probably benign Het
Actn1 A G 12: 80,215,197 (GRCm39) C860R probably damaging Het
Adam23 T A 1: 63,554,744 (GRCm39) L170Q probably damaging Het
Afdn C T 17: 14,116,401 (GRCm39) R1620* probably null Het
Agfg1 A G 1: 82,848,525 (GRCm39) probably benign Het
Aire A G 10: 77,870,298 (GRCm39) S476P probably damaging Het
Arhgef26 A G 3: 62,247,401 (GRCm39) T162A probably benign Het
Atp1a2 T C 1: 172,113,222 (GRCm39) Q487R probably null Het
BC048507 T A 13: 68,011,628 (GRCm39) C2S probably benign Het
Bltp1 G T 3: 37,087,503 (GRCm39) A615S possibly damaging Het
Bnc2 A C 4: 84,209,707 (GRCm39) probably benign Het
Bop1 C T 15: 76,338,524 (GRCm39) G473R probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
Cacna1i T C 15: 80,258,894 (GRCm39) V1201A possibly damaging Het
Cecr2 C A 6: 120,715,162 (GRCm39) T249K probably damaging Het
Clca3a2 C A 3: 144,790,810 (GRCm39) G421* probably null Het
Clec1b A T 6: 129,378,703 (GRCm39) probably null Het
Cnksr3 C T 10: 7,104,467 (GRCm39) D79N probably damaging Het
Col15a1 A G 4: 47,287,091 (GRCm39) Q843R probably damaging Het
Col6a3 T C 1: 90,755,948 (GRCm39) S114G probably benign Het
Corin A T 5: 72,486,953 (GRCm39) probably null Het
Cyp2u1 A G 3: 131,096,503 (GRCm39) Y92H probably damaging Het
Dcbld2 T C 16: 58,229,270 (GRCm39) L51P probably damaging Het
Dip2c T A 13: 9,673,989 (GRCm39) probably benign Het
Dlc1 A T 8: 37,051,481 (GRCm39) V299E probably benign Het
Dlgap2 G A 8: 14,229,682 (GRCm39) probably null Het
Dnah1 A G 14: 31,032,997 (GRCm39) L346P probably damaging Het
Dnah9 T C 11: 65,746,210 (GRCm39) T3968A probably benign Het
Duox2 A C 2: 122,120,044 (GRCm39) M822R probably null Het
E2f7 A T 10: 110,610,674 (GRCm39) Q433L probably benign Het
Eif3k A C 7: 28,679,901 (GRCm39) Y42* probably null Het
Elmod3 A G 6: 72,563,494 (GRCm39) S45P probably damaging Het
Emilin3 C A 2: 160,751,108 (GRCm39) V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 (GRCm39) F283L probably benign Het
Fbxw7 T C 3: 84,876,549 (GRCm39) Y358H Het
G430095P16Rik A G 8: 85,453,043 (GRCm39) N10S unknown Het
Gldc A G 19: 30,111,156 (GRCm39) V540A possibly damaging Het
Gm3667 T A 14: 18,271,553 (GRCm39) E67D probably benign Het
Golga3 T A 5: 110,353,626 (GRCm39) probably benign Het
H60c T C 10: 3,217,255 (GRCm39) E38G probably benign Het
Hectd4 A G 5: 121,433,541 (GRCm39) D952G probably benign Het
Hoxb8 T A 11: 96,175,223 (GRCm39) L220Q probably damaging Het
Ice1 A T 13: 70,751,050 (GRCm39) L1679M probably damaging Het
Ifi202b T A 1: 173,802,480 (GRCm39) Y118F probably damaging Het
Ift122 A T 6: 115,868,880 (GRCm39) T456S probably benign Het
Ighg3 G A 12: 113,323,845 (GRCm39) T181I Het
Ighv1-66 C A 12: 115,557,032 (GRCm39) V17F probably damaging Het
Ighv5-12-4 A G 12: 113,726,130 (GRCm39) V31A possibly damaging Het
Ints12 T A 3: 132,815,003 (GRCm39) N403K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kalrn A C 16: 34,047,496 (GRCm39) N908K probably benign Het
Kctd9 G A 14: 67,962,016 (GRCm39) V20I unknown Het
Krt78 G T 15: 101,861,746 (GRCm39) L167M probably damaging Het
Ldb1 T C 19: 46,023,294 (GRCm39) E206G probably damaging Het
Lig1 A G 7: 13,030,713 (GRCm39) Y455C probably damaging Het
Ltbp1 T G 17: 75,486,077 (GRCm39) I34S probably damaging Het
Map2 T C 1: 66,454,758 (GRCm39) I1216T possibly damaging Het
Mex3c T C 18: 73,706,800 (GRCm39) V229A probably damaging Het
Mfsd11 T C 11: 116,745,526 (GRCm39) probably null Het
Mroh1 A G 15: 76,331,474 (GRCm39) T1233A probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nipbl A T 15: 8,391,271 (GRCm39) H234Q probably damaging Het
Npc1l1 G A 11: 6,175,665 (GRCm39) P549S probably damaging Het
Or12d2 A T 17: 37,624,642 (GRCm39) L211Q probably damaging Het
Or4c3 A G 2: 89,852,269 (GRCm39) V47A probably benign Het
Or5h22 A T 16: 58,894,846 (GRCm39) V199D possibly damaging Het
Or5w22 A G 2: 87,363,187 (GRCm39) D270G possibly damaging Het
Or6c3b A T 10: 129,527,372 (GRCm39) Y179* probably null Het
Padi3 A T 4: 140,523,795 (GRCm39) C228* probably null Het
Palld T A 8: 61,986,512 (GRCm39) D1015V unknown Het
Pcna-ps2 A T 19: 9,261,488 (GRCm39) Y249F probably benign Het
Pelo C T 13: 115,225,451 (GRCm39) C258Y probably benign Het
Ppp1r13b A T 12: 111,803,430 (GRCm39) probably benign Het
Pramel26 A G 4: 143,539,257 (GRCm39) F79L probably damaging Het
Prdm2 A G 4: 142,860,771 (GRCm39) W840R probably damaging Het
Prkcg A G 7: 3,370,857 (GRCm39) D428G possibly damaging Het
Pus7 G A 5: 23,948,476 (GRCm39) R571* probably null Het
Rdh13 T C 7: 4,434,522 (GRCm39) D186G probably damaging Het
Rslcan18 T A 13: 67,246,793 (GRCm39) H273L probably damaging Het
Rxfp1 T A 3: 79,559,289 (GRCm39) probably benign Het
Sh3bp1 T A 15: 78,788,540 (GRCm39) probably null Het
Siglecg T A 7: 43,058,008 (GRCm39) S9T probably benign Het
Slc9a1 T C 4: 133,139,258 (GRCm39) F159L probably benign Het
Slc9a2 A G 1: 40,758,009 (GRCm39) I183V probably benign Het
St6galnac4 A G 2: 32,484,110 (GRCm39) M103V probably damaging Het
Tbc1d30 T C 10: 121,187,059 (GRCm39) D42G possibly damaging Het
Tlr5 C A 1: 182,801,332 (GRCm39) T212K probably benign Het
Trim43b T G 9: 88,969,642 (GRCm39) I269L probably benign Het
Ttll6 T C 11: 96,047,492 (GRCm39) L697P possibly damaging Het
Ttn T G 2: 76,549,239 (GRCm39) T31813P probably damaging Het
Ttn A T 2: 76,571,932 (GRCm39) D26320E probably damaging Het
Uba6 A G 5: 86,307,061 (GRCm39) probably null Het
Usp1 C G 4: 98,819,185 (GRCm39) Q216E probably benign Het
Vcan T C 13: 89,853,026 (GRCm39) T645A probably benign Het
Wdr64 C A 1: 175,599,850 (GRCm39) P559H probably benign Het
Zfat T C 15: 68,056,315 (GRCm39) Y247C probably damaging Het
Zfp979 A T 4: 147,698,219 (GRCm39) N163K probably damaging Het
Other mutations in Rab11fip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rab11fip3 APN 17 26,210,783 (GRCm39) splice site probably benign
IGL00420:Rab11fip3 APN 17 26,286,599 (GRCm39) missense probably benign 0.20
IGL01291:Rab11fip3 APN 17 26,235,087 (GRCm39) missense probably damaging 0.99
IGL01473:Rab11fip3 APN 17 26,287,709 (GRCm39) missense possibly damaging 0.53
IGL01687:Rab11fip3 APN 17 26,286,956 (GRCm39) missense probably damaging 0.97
IGL01764:Rab11fip3 APN 17 26,287,667 (GRCm39) missense probably benign 0.02
IGL01977:Rab11fip3 APN 17 26,286,977 (GRCm39) missense possibly damaging 0.72
IGL02140:Rab11fip3 APN 17 26,286,866 (GRCm39) missense probably benign 0.33
IGL02434:Rab11fip3 APN 17 26,287,809 (GRCm39) missense possibly damaging 0.85
IGL02549:Rab11fip3 APN 17 26,213,294 (GRCm39) missense probably damaging 0.96
IGL02889:Rab11fip3 APN 17 26,286,653 (GRCm39) missense possibly damaging 0.84
IGL02953:Rab11fip3 APN 17 26,286,653 (GRCm39) missense possibly damaging 0.84
ANU05:Rab11fip3 UTSW 17 26,235,087 (GRCm39) missense probably damaging 0.99
R0193:Rab11fip3 UTSW 17 26,209,973 (GRCm39) missense probably damaging 0.99
R0388:Rab11fip3 UTSW 17 26,288,046 (GRCm39) missense probably benign 0.33
R0543:Rab11fip3 UTSW 17 26,213,199 (GRCm39) missense probably damaging 1.00
R0678:Rab11fip3 UTSW 17 26,287,821 (GRCm39) missense probably benign 0.00
R1283:Rab11fip3 UTSW 17 26,223,528 (GRCm39) missense probably damaging 1.00
R1473:Rab11fip3 UTSW 17 26,210,296 (GRCm39) missense probably damaging 1.00
R1625:Rab11fip3 UTSW 17 26,287,865 (GRCm39) missense possibly damaging 0.72
R1973:Rab11fip3 UTSW 17 26,243,365 (GRCm39) missense probably damaging 0.97
R2160:Rab11fip3 UTSW 17 26,288,028 (GRCm39) missense probably benign 0.33
R2197:Rab11fip3 UTSW 17 26,287,152 (GRCm39) missense probably benign
R2382:Rab11fip3 UTSW 17 26,209,841 (GRCm39) nonsense probably null
R3028:Rab11fip3 UTSW 17 26,234,916 (GRCm39) critical splice donor site probably null
R3797:Rab11fip3 UTSW 17 26,287,500 (GRCm39) missense possibly damaging 0.73
R4012:Rab11fip3 UTSW 17 26,287,002 (GRCm39) frame shift probably null
R4064:Rab11fip3 UTSW 17 26,243,368 (GRCm39) missense probably damaging 0.97
R4478:Rab11fip3 UTSW 17 26,235,057 (GRCm39) missense probably damaging 1.00
R4527:Rab11fip3 UTSW 17 26,255,631 (GRCm39) missense probably damaging 1.00
R4565:Rab11fip3 UTSW 17 26,287,680 (GRCm39) missense possibly damaging 0.73
R5048:Rab11fip3 UTSW 17 26,286,554 (GRCm39) critical splice donor site probably null
R5138:Rab11fip3 UTSW 17 26,210,000 (GRCm39) missense probably benign 0.32
R5317:Rab11fip3 UTSW 17 26,287,052 (GRCm39) missense possibly damaging 0.72
R5453:Rab11fip3 UTSW 17 26,211,555 (GRCm39) critical splice donor site probably null
R5495:Rab11fip3 UTSW 17 26,235,117 (GRCm39) missense probably damaging 0.99
R5525:Rab11fip3 UTSW 17 26,210,269 (GRCm39) missense probably damaging 1.00
R5654:Rab11fip3 UTSW 17 26,235,038 (GRCm39) missense probably damaging 1.00
R5716:Rab11fip3 UTSW 17 26,255,638 (GRCm39) missense probably damaging 1.00
R5818:Rab11fip3 UTSW 17 26,235,090 (GRCm39) missense probably damaging 1.00
R6044:Rab11fip3 UTSW 17 26,286,843 (GRCm39) missense possibly damaging 0.93
R6716:Rab11fip3 UTSW 17 26,210,031 (GRCm39) missense probably damaging 1.00
R6785:Rab11fip3 UTSW 17 26,210,692 (GRCm39) missense probably damaging 0.99
R7161:Rab11fip3 UTSW 17 26,288,064 (GRCm39) missense probably benign 0.09
R7390:Rab11fip3 UTSW 17 26,287,126 (GRCm39) missense possibly damaging 0.81
R7447:Rab11fip3 UTSW 17 26,287,848 (GRCm39) missense possibly damaging 0.66
R7836:Rab11fip3 UTSW 17 26,287,232 (GRCm39) missense possibly damaging 0.82
R7981:Rab11fip3 UTSW 17 26,216,963 (GRCm39) missense probably damaging 0.98
R8008:Rab11fip3 UTSW 17 26,286,956 (GRCm39) missense probably damaging 0.97
R8962:Rab11fip3 UTSW 17 26,231,007 (GRCm39) missense probably damaging 1.00
R9250:Rab11fip3 UTSW 17 26,237,219 (GRCm39) missense unknown
R9329:Rab11fip3 UTSW 17 26,231,032 (GRCm39) missense probably benign 0.15
R9506:Rab11fip3 UTSW 17 26,213,250 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAGGGCGTCAAATAC -3'
(R):5'- CTTGGTCAAGGAACCAGAGG -3'

Sequencing Primer
(F):5'- GTCAAATACCGCCCTGAGG -3'
(R):5'- GAGGCCGATGCACTTCACTG -3'
Posted On 2021-08-02