Incidental Mutation 'R8887:Gldc'
ID 677452
Institutional Source Beutler Lab
Gene Symbol Gldc
Ensembl Gene ENSMUSG00000024827
Gene Name glycine decarboxylase
Synonyms b2b2679Clo, D030049L12Rik, D19Wsu57e
MMRRC Submission 068752-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8887 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 30075847-30152829 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30111156 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 540 (V540A)
Ref Sequence ENSEMBL: ENSMUSP00000025778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025778]
AlphaFold Q91W43
Predicted Effect possibly damaging
Transcript: ENSMUST00000025778
AA Change: V540A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025778
Gene: ENSMUSG00000024827
AA Change: V540A

DomainStartEndE-ValueType
low complexity region 5 28 N/A INTRINSIC
low complexity region 33 56 N/A INTRINSIC
Pfam:GDC-P 70 493 1.1e-202 PFAM
low complexity region 504 515 N/A INTRINSIC
Pfam:GDC-P 519 798 6.5e-8 PFAM
Pfam:Beta_elim_lyase 589 745 2e-10 PFAM
Meta Mutation Damage Score 0.2060 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). The protein encoded by this gene is the P protein, which binds to glycine and enables the methylamine group from glycine to be transferred to the T protein. Defects in this gene are a cause of nonketotic hyperglycinemia (NKH).[provided by RefSeq, Jan 2010]
PHENOTYPE: Hypomorphic mutants show a developmental delay, hyperglycinemia, altered folate profiles, neural tube defects and postnatal lethality, while survivors show hydrocephaly and premature death. Homozygotes for an ENU allele show omphalocele and severe cardiovascular, craniofacial, renal and eye defects. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 T C 17: 57,175,285 (GRCm39) T76A probably benign Het
Actn1 A G 12: 80,215,197 (GRCm39) C860R probably damaging Het
Adam23 T A 1: 63,554,744 (GRCm39) L170Q probably damaging Het
Afdn C T 17: 14,116,401 (GRCm39) R1620* probably null Het
Agfg1 A G 1: 82,848,525 (GRCm39) probably benign Het
Aire A G 10: 77,870,298 (GRCm39) S476P probably damaging Het
Arhgef26 A G 3: 62,247,401 (GRCm39) T162A probably benign Het
Atp1a2 T C 1: 172,113,222 (GRCm39) Q487R probably null Het
BC048507 T A 13: 68,011,628 (GRCm39) C2S probably benign Het
Bltp1 G T 3: 37,087,503 (GRCm39) A615S possibly damaging Het
Bnc2 A C 4: 84,209,707 (GRCm39) probably benign Het
Bop1 C T 15: 76,338,524 (GRCm39) G473R probably damaging Het
C1galt1 A G 6: 7,866,379 (GRCm39) E75G probably benign Het
Cacna1i T C 15: 80,258,894 (GRCm39) V1201A possibly damaging Het
Cecr2 C A 6: 120,715,162 (GRCm39) T249K probably damaging Het
Clca3a2 C A 3: 144,790,810 (GRCm39) G421* probably null Het
Clec1b A T 6: 129,378,703 (GRCm39) probably null Het
Cnksr3 C T 10: 7,104,467 (GRCm39) D79N probably damaging Het
Col15a1 A G 4: 47,287,091 (GRCm39) Q843R probably damaging Het
Col6a3 T C 1: 90,755,948 (GRCm39) S114G probably benign Het
Corin A T 5: 72,486,953 (GRCm39) probably null Het
Cyp2u1 A G 3: 131,096,503 (GRCm39) Y92H probably damaging Het
Dcbld2 T C 16: 58,229,270 (GRCm39) L51P probably damaging Het
Dip2c T A 13: 9,673,989 (GRCm39) probably benign Het
Dlc1 A T 8: 37,051,481 (GRCm39) V299E probably benign Het
Dlgap2 G A 8: 14,229,682 (GRCm39) probably null Het
Dnah1 A G 14: 31,032,997 (GRCm39) L346P probably damaging Het
Dnah9 T C 11: 65,746,210 (GRCm39) T3968A probably benign Het
Duox2 A C 2: 122,120,044 (GRCm39) M822R probably null Het
E2f7 A T 10: 110,610,674 (GRCm39) Q433L probably benign Het
Eif3k A C 7: 28,679,901 (GRCm39) Y42* probably null Het
Elmod3 A G 6: 72,563,494 (GRCm39) S45P probably damaging Het
Emilin3 C A 2: 160,751,108 (GRCm39) V214F possibly damaging Het
Fbxo10 A T 4: 45,058,887 (GRCm39) F283L probably benign Het
Fbxw7 T C 3: 84,876,549 (GRCm39) Y358H Het
G430095P16Rik A G 8: 85,453,043 (GRCm39) N10S unknown Het
Gm3667 T A 14: 18,271,553 (GRCm39) E67D probably benign Het
Golga3 T A 5: 110,353,626 (GRCm39) probably benign Het
H60c T C 10: 3,217,255 (GRCm39) E38G probably benign Het
Hectd4 A G 5: 121,433,541 (GRCm39) D952G probably benign Het
Hoxb8 T A 11: 96,175,223 (GRCm39) L220Q probably damaging Het
Ice1 A T 13: 70,751,050 (GRCm39) L1679M probably damaging Het
Ifi202b T A 1: 173,802,480 (GRCm39) Y118F probably damaging Het
Ift122 A T 6: 115,868,880 (GRCm39) T456S probably benign Het
Ighg3 G A 12: 113,323,845 (GRCm39) T181I Het
Ighv1-66 C A 12: 115,557,032 (GRCm39) V17F probably damaging Het
Ighv5-12-4 A G 12: 113,726,130 (GRCm39) V31A possibly damaging Het
Ints12 T A 3: 132,815,003 (GRCm39) N403K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kalrn A C 16: 34,047,496 (GRCm39) N908K probably benign Het
Kctd9 G A 14: 67,962,016 (GRCm39) V20I unknown Het
Krt78 G T 15: 101,861,746 (GRCm39) L167M probably damaging Het
Ldb1 T C 19: 46,023,294 (GRCm39) E206G probably damaging Het
Lig1 A G 7: 13,030,713 (GRCm39) Y455C probably damaging Het
Ltbp1 T G 17: 75,486,077 (GRCm39) I34S probably damaging Het
Map2 T C 1: 66,454,758 (GRCm39) I1216T possibly damaging Het
Mex3c T C 18: 73,706,800 (GRCm39) V229A probably damaging Het
Mfsd11 T C 11: 116,745,526 (GRCm39) probably null Het
Mroh1 A G 15: 76,331,474 (GRCm39) T1233A probably benign Het
Myct1 C T 10: 5,554,208 (GRCm39) T25I probably damaging Het
Nipbl A T 15: 8,391,271 (GRCm39) H234Q probably damaging Het
Npc1l1 G A 11: 6,175,665 (GRCm39) P549S probably damaging Het
Or12d2 A T 17: 37,624,642 (GRCm39) L211Q probably damaging Het
Or4c3 A G 2: 89,852,269 (GRCm39) V47A probably benign Het
Or5h22 A T 16: 58,894,846 (GRCm39) V199D possibly damaging Het
Or5w22 A G 2: 87,363,187 (GRCm39) D270G possibly damaging Het
Or6c3b A T 10: 129,527,372 (GRCm39) Y179* probably null Het
Padi3 A T 4: 140,523,795 (GRCm39) C228* probably null Het
Palld T A 8: 61,986,512 (GRCm39) D1015V unknown Het
Pcna-ps2 A T 19: 9,261,488 (GRCm39) Y249F probably benign Het
Pelo C T 13: 115,225,451 (GRCm39) C258Y probably benign Het
Ppp1r13b A T 12: 111,803,430 (GRCm39) probably benign Het
Pramel26 A G 4: 143,539,257 (GRCm39) F79L probably damaging Het
Prdm2 A G 4: 142,860,771 (GRCm39) W840R probably damaging Het
Prkcg A G 7: 3,370,857 (GRCm39) D428G possibly damaging Het
Pus7 G A 5: 23,948,476 (GRCm39) R571* probably null Het
Rab11fip3 A G 17: 26,286,927 (GRCm39) C409R possibly damaging Het
Rdh13 T C 7: 4,434,522 (GRCm39) D186G probably damaging Het
Rslcan18 T A 13: 67,246,793 (GRCm39) H273L probably damaging Het
Rxfp1 T A 3: 79,559,289 (GRCm39) probably benign Het
Sh3bp1 T A 15: 78,788,540 (GRCm39) probably null Het
Siglecg T A 7: 43,058,008 (GRCm39) S9T probably benign Het
Slc9a1 T C 4: 133,139,258 (GRCm39) F159L probably benign Het
Slc9a2 A G 1: 40,758,009 (GRCm39) I183V probably benign Het
St6galnac4 A G 2: 32,484,110 (GRCm39) M103V probably damaging Het
Tbc1d30 T C 10: 121,187,059 (GRCm39) D42G possibly damaging Het
Tlr5 C A 1: 182,801,332 (GRCm39) T212K probably benign Het
Trim43b T G 9: 88,969,642 (GRCm39) I269L probably benign Het
Ttll6 T C 11: 96,047,492 (GRCm39) L697P possibly damaging Het
Ttn T G 2: 76,549,239 (GRCm39) T31813P probably damaging Het
Ttn A T 2: 76,571,932 (GRCm39) D26320E probably damaging Het
Uba6 A G 5: 86,307,061 (GRCm39) probably null Het
Usp1 C G 4: 98,819,185 (GRCm39) Q216E probably benign Het
Vcan T C 13: 89,853,026 (GRCm39) T645A probably benign Het
Wdr64 C A 1: 175,599,850 (GRCm39) P559H probably benign Het
Zfat T C 15: 68,056,315 (GRCm39) Y247C probably damaging Het
Zfp979 A T 4: 147,698,219 (GRCm39) N163K probably damaging Het
Other mutations in Gldc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Gldc APN 19 30,092,640 (GRCm39) missense probably damaging 1.00
IGL01016:Gldc APN 19 30,110,893 (GRCm39) missense possibly damaging 0.93
IGL01112:Gldc APN 19 30,135,913 (GRCm39) critical splice donor site probably null
IGL01510:Gldc APN 19 30,091,121 (GRCm39) critical splice donor site probably null
IGL01516:Gldc APN 19 30,076,432 (GRCm39) missense probably damaging 1.00
IGL01598:Gldc APN 19 30,111,156 (GRCm39) missense probably damaging 1.00
IGL01646:Gldc APN 19 30,078,165 (GRCm39) missense possibly damaging 0.61
IGL02024:Gldc APN 19 30,078,227 (GRCm39) missense probably damaging 1.00
IGL02125:Gldc APN 19 30,124,641 (GRCm39) missense probably benign 0.03
IGL02548:Gldc APN 19 30,077,299 (GRCm39) missense probably benign
IGL02711:Gldc APN 19 30,122,546 (GRCm39) critical splice donor site probably null
IGL02818:Gldc APN 19 30,113,909 (GRCm39) missense probably damaging 0.99
IGL02982:Gldc APN 19 30,122,545 (GRCm39) critical splice donor site probably null
IGL03165:Gldc APN 19 30,076,393 (GRCm39) missense possibly damaging 0.61
jojoba UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
miserable UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
Urchin UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
I2289:Gldc UTSW 19 30,124,576 (GRCm39) nonsense probably null
R0180:Gldc UTSW 19 30,078,217 (GRCm39) missense possibly damaging 0.95
R0269:Gldc UTSW 19 30,096,002 (GRCm39) missense probably damaging 0.98
R0277:Gldc UTSW 19 30,093,851 (GRCm39) missense possibly damaging 0.84
R1085:Gldc UTSW 19 30,128,828 (GRCm39) missense probably damaging 1.00
R1159:Gldc UTSW 19 30,138,162 (GRCm39) intron probably benign
R1500:Gldc UTSW 19 30,091,225 (GRCm39) missense possibly damaging 0.88
R1507:Gldc UTSW 19 30,096,038 (GRCm39) missense probably damaging 1.00
R1592:Gldc UTSW 19 30,138,077 (GRCm39) intron probably benign
R1593:Gldc UTSW 19 30,091,150 (GRCm39) missense probably damaging 1.00
R1675:Gldc UTSW 19 30,120,853 (GRCm39) missense probably damaging 1.00
R1869:Gldc UTSW 19 30,116,732 (GRCm39) missense probably benign
R1965:Gldc UTSW 19 30,114,513 (GRCm39) nonsense probably null
R2312:Gldc UTSW 19 30,078,226 (GRCm39) missense probably damaging 0.98
R2425:Gldc UTSW 19 30,109,190 (GRCm39) missense probably damaging 1.00
R3836:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3837:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R3839:Gldc UTSW 19 30,096,075 (GRCm39) splice site probably benign
R4191:Gldc UTSW 19 30,123,058 (GRCm39) missense probably damaging 0.96
R4380:Gldc UTSW 19 30,138,168 (GRCm39) intron probably benign
R4508:Gldc UTSW 19 30,120,807 (GRCm39) missense probably damaging 1.00
R4570:Gldc UTSW 19 30,151,839 (GRCm39) missense probably benign
R4655:Gldc UTSW 19 30,138,102 (GRCm39) intron probably benign
R4842:Gldc UTSW 19 30,111,132 (GRCm39) missense possibly damaging 0.94
R5070:Gldc UTSW 19 30,095,998 (GRCm39) missense possibly damaging 0.84
R5085:Gldc UTSW 19 30,128,936 (GRCm39) missense probably damaging 1.00
R5268:Gldc UTSW 19 30,123,125 (GRCm39) missense probably damaging 0.96
R5368:Gldc UTSW 19 30,135,921 (GRCm39) missense probably benign
R5718:Gldc UTSW 19 30,088,172 (GRCm39) nonsense probably null
R5878:Gldc UTSW 19 30,120,867 (GRCm39) splice site probably null
R6192:Gldc UTSW 19 30,111,172 (GRCm39) missense probably damaging 0.98
R6453:Gldc UTSW 19 30,093,917 (GRCm39) missense probably damaging 0.99
R6777:Gldc UTSW 19 30,110,912 (GRCm39) missense probably damaging 1.00
R6865:Gldc UTSW 19 30,111,162 (GRCm39) missense possibly damaging 0.92
R7332:Gldc UTSW 19 30,093,926 (GRCm39) missense probably damaging 0.99
R7390:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.46
R7647:Gldc UTSW 19 30,096,067 (GRCm39) missense probably damaging 0.96
R8081:Gldc UTSW 19 30,135,987 (GRCm39) frame shift probably null
R8171:Gldc UTSW 19 30,111,161 (GRCm39) missense probably benign 0.24
R8321:Gldc UTSW 19 30,120,807 (GRCm39) nonsense probably null
R8374:Gldc UTSW 19 30,114,594 (GRCm39) missense probably damaging 1.00
R8503:Gldc UTSW 19 30,077,254 (GRCm39) missense probably benign 0.26
R8510:Gldc UTSW 19 30,093,905 (GRCm39) missense probably damaging 1.00
R8785:Gldc UTSW 19 30,092,634 (GRCm39) missense probably damaging 1.00
R8818:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8820:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8829:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8830:Gldc UTSW 19 30,078,212 (GRCm39) missense probably benign 0.05
R8859:Gldc UTSW 19 30,116,779 (GRCm39) missense probably damaging 1.00
R8935:Gldc UTSW 19 30,109,093 (GRCm39) missense probably benign 0.00
R8940:Gldc UTSW 19 30,128,884 (GRCm39) missense probably benign
R9070:Gldc UTSW 19 30,080,404 (GRCm39) missense probably damaging 1.00
R9100:Gldc UTSW 19 30,077,314 (GRCm39) missense possibly damaging 0.81
R9144:Gldc UTSW 19 30,114,593 (GRCm39) missense
R9163:Gldc UTSW 19 30,111,686 (GRCm39) missense probably benign 0.13
R9429:Gldc UTSW 19 30,091,172 (GRCm39) missense possibly damaging 0.88
Z1177:Gldc UTSW 19 30,123,148 (GRCm39) missense possibly damaging 0.61
Z1177:Gldc UTSW 19 30,088,179 (GRCm39) missense probably damaging 0.99
Z1177:Gldc UTSW 19 30,088,178 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATGCCCCATCTATGAAC -3'
(R):5'- AGTTCATCTCAGGAACCCCG -3'

Sequencing Primer
(F):5'- ATGCCCCATCTATGAACCTTCC -3'
(R):5'- CAGTGGCCCCTTGTTGCTAG -3'
Posted On 2021-08-02