Incidental Mutation 'R8888:Atp8b5'
ID677468
Institutional Source Beutler Lab
Gene Symbol Atp8b5
Ensembl Gene ENSMUSG00000028457
Gene NameATPase, class I, type 8B, member 5
Synonyms4930417M19Rik, FetA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8888 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43267159-43373833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43304687 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 66 (N66S)
Ref Sequence ENSEMBL: ENSMUSP00000103575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102953] [ENSMUST00000107937] [ENSMUST00000107942] [ENSMUST00000136262]
Predicted Effect probably benign
Transcript: ENSMUST00000102953
AA Change: N66S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100018
Gene: ENSMUSG00000028457
AA Change: N66S

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
Blast:CUB 55 90 1e-6 BLAST
Pfam:E1-E2_ATPase 107 305 4.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107937
Predicted Effect
SMART Domains Protein: ENSMUSP00000103575
Gene: ENSMUSG00000028457
AA Change: N66S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 38 104 1.8e-26 PFAM
Pfam:E1-E2_ATPase 103 375 4.9e-9 PFAM
Pfam:HAD 413 847 2e-18 PFAM
Pfam:Cation_ATPase 495 594 1e-9 PFAM
Pfam:PhoLip_ATPase_C 864 1118 2.6e-77 PFAM
low complexity region 1171 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136262
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Ankrd12 T C 17: 66,031,573 probably null Het
Bean1 CT C 8: 104,182,032 probably null Het
Birc6 G A 17: 74,528,538 S24N probably null Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Cdh1 T A 8: 106,604,339 F34Y probably damaging Het
Cdh5 T C 8: 104,125,460 I69T possibly damaging Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Clasp2 T A 9: 113,903,868 M924K possibly damaging Het
Col3a1 G A 1: 45,339,979 A850T unknown Het
Cped1 C T 6: 22,016,963 P104S possibly damaging Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dopey1 A G 9: 86,521,534 I132V probably benign Het
Dpysl5 C T 5: 30,745,343 R40C probably benign Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Epg5 C A 18: 78,012,871 D1753E possibly damaging Het
Ext1 T C 15: 53,092,327 Y458C probably damaging Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Frmd6 C A 12: 70,893,872 H430Q possibly damaging Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Htr2a C T 14: 74,645,177 T201I possibly damaging Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Klhl29 A T 12: 5,137,542 L274H possibly damaging Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Nek5 C T 8: 22,090,479 probably null Het
Nlrc5 G A 8: 94,525,490 V1880I probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr1318 G A 2: 112,156,629 R226H probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Pik3c2g A T 6: 139,730,366 K79* probably null Het
Pou3f1 C G 4: 124,658,359 A218G possibly damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spdye4a T G 5: 143,225,663 S49R probably benign Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Syt14 A G 1: 192,897,558 S473P probably damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Usp2 G T 9: 44,075,597 R64L probably benign Het
Other mutations in Atp8b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Atp8b5 APN 4 43355567 missense probably damaging 1.00
IGL00970:Atp8b5 APN 4 43311938 missense probably benign 0.01
IGL01335:Atp8b5 APN 4 43302628 missense possibly damaging 0.90
IGL01462:Atp8b5 APN 4 43368010 missense possibly damaging 0.90
IGL01657:Atp8b5 APN 4 43291693 missense probably benign 0.04
IGL01935:Atp8b5 APN 4 43366638 missense probably benign 0.03
IGL01977:Atp8b5 APN 4 43320590 critical splice acceptor site probably null
IGL02102:Atp8b5 APN 4 43364167 missense probably benign 0.10
IGL02369:Atp8b5 APN 4 43334205 missense probably benign
IGL02456:Atp8b5 APN 4 43365578 missense probably benign 0.16
IGL02696:Atp8b5 APN 4 43369634 missense possibly damaging 0.61
IGL02826:Atp8b5 APN 4 43366770 missense probably damaging 1.00
IGL02947:Atp8b5 APN 4 43305774 missense possibly damaging 0.49
R0128:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0130:Atp8b5 UTSW 4 43369715 critical splice donor site probably null
R0243:Atp8b5 UTSW 4 43366057 missense probably benign
R0256:Atp8b5 UTSW 4 43302576 intron probably benign
R0379:Atp8b5 UTSW 4 43361898 missense probably damaging 0.99
R0671:Atp8b5 UTSW 4 43291672 missense possibly damaging 0.83
R1109:Atp8b5 UTSW 4 43305719 intron probably benign
R1442:Atp8b5 UTSW 4 43334313 missense probably damaging 0.99
R1454:Atp8b5 UTSW 4 43302590 missense probably benign
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1469:Atp8b5 UTSW 4 43291733 critical splice donor site probably null
R1503:Atp8b5 UTSW 4 43344430 missense probably damaging 1.00
R1580:Atp8b5 UTSW 4 43355673 missense possibly damaging 0.49
R1677:Atp8b5 UTSW 4 43372903 missense possibly damaging 0.61
R1861:Atp8b5 UTSW 4 43372906 missense probably damaging 1.00
R1899:Atp8b5 UTSW 4 43361804 missense possibly damaging 0.47
R1903:Atp8b5 UTSW 4 43357063 missense probably damaging 0.98
R1961:Atp8b5 UTSW 4 43369688 missense probably damaging 0.98
R2131:Atp8b5 UTSW 4 43370726 missense probably benign 0.33
R2971:Atp8b5 UTSW 4 43361953 splice site probably benign
R3023:Atp8b5 UTSW 4 43311957 missense possibly damaging 0.82
R3433:Atp8b5 UTSW 4 43372697 missense probably benign
R3690:Atp8b5 UTSW 4 43368055 missense probably damaging 1.00
R4157:Atp8b5 UTSW 4 43365591 missense probably damaging 0.97
R4484:Atp8b5 UTSW 4 43357016 missense probably damaging 1.00
R4510:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4511:Atp8b5 UTSW 4 43320629 missense probably damaging 1.00
R4679:Atp8b5 UTSW 4 43365955 missense probably benign 0.16
R4753:Atp8b5 UTSW 4 43372710 missense probably damaging 1.00
R4761:Atp8b5 UTSW 4 43308504 makesense probably null
R4784:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4785:Atp8b5 UTSW 4 43356980 missense probably damaging 0.97
R4855:Atp8b5 UTSW 4 43344449 missense probably benign
R5422:Atp8b5 UTSW 4 43366644 missense probably benign 0.10
R5915:Atp8b5 UTSW 4 43370577 missense probably damaging 1.00
R6228:Atp8b5 UTSW 4 43304674 missense probably damaging 1.00
R6496:Atp8b5 UTSW 4 43371003 missense probably benign 0.03
R6708:Atp8b5 UTSW 4 43334249 missense probably benign
R6931:Atp8b5 UTSW 4 43364108 critical splice acceptor site probably null
R7021:Atp8b5 UTSW 4 43355618 missense probably damaging 0.99
R7085:Atp8b5 UTSW 4 43361835 missense probably damaging 1.00
R7207:Atp8b5 UTSW 4 43357018 missense probably damaging 0.97
R7404:Atp8b5 UTSW 4 43342640 missense probably benign 0.10
R7448:Atp8b5 UTSW 4 43366021 missense probably benign
R7465:Atp8b5 UTSW 4 43271269 missense probably benign 0.00
R7526:Atp8b5 UTSW 4 43366609 missense probably damaging 0.99
R7616:Atp8b5 UTSW 4 43370823 critical splice donor site probably null
R7698:Atp8b5 UTSW 4 43366735 missense probably benign 0.27
R7883:Atp8b5 UTSW 4 43342471 missense probably damaging 0.99
R8052:Atp8b5 UTSW 4 43356982 nonsense probably null
R8218:Atp8b5 UTSW 4 43372728 critical splice donor site probably null
R8248:Atp8b5 UTSW 4 43366072 missense probably damaging 0.97
R8345:Atp8b5 UTSW 4 43291714 missense probably benign 0.01
R8756:Atp8b5 UTSW 4 43342439 missense probably damaging 0.98
R8942:Atp8b5 UTSW 4 43353658 missense probably damaging 1.00
X0025:Atp8b5 UTSW 4 43366774 missense probably damaging 1.00
Z1176:Atp8b5 UTSW 4 43361903 missense probably benign 0.40
Z1177:Atp8b5 UTSW 4 43370669 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGTATTGACAGTTCCTGCCAC -3'
(R):5'- TTGGACTAAGACTCCAGGTAGC -3'

Sequencing Primer
(F):5'- TGCCACAGGTTTAATAAGACCC -3'
(R):5'- GACTAAGACTCCAGGTAGCCATTTG -3'
Posted On2021-08-02