Incidental Mutation 'R8888:Ext1'
ID 677517
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Name exostoses (multiple) 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8888 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 53064038-53346159 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53092327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 458 (Y458C)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
AlphaFold P97464
Predicted Effect probably damaging
Transcript: ENSMUST00000077273
AA Change: Y458C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: Y458C

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Ankrd12 T C 17: 66,031,573 probably null Het
Atp8b5 A G 4: 43,304,687 N66S Het
Bean1 CT C 8: 104,182,032 probably null Het
Birc6 G A 17: 74,528,538 S24N probably null Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Capn12 T A 7: 28,886,524 probably benign Het
Cdh1 T A 8: 106,604,339 F34Y probably damaging Het
Cdh5 T C 8: 104,125,460 I69T possibly damaging Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Clasp2 T A 9: 113,903,868 M924K possibly damaging Het
Col3a1 G A 1: 45,339,979 A850T unknown Het
Cped1 C T 6: 22,016,963 P104S possibly damaging Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dopey1 A G 9: 86,521,534 I132V probably benign Het
Dpysl5 C T 5: 30,745,343 R40C probably benign Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Epg5 C A 18: 78,012,871 D1753E possibly damaging Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Frmd6 C A 12: 70,893,872 H430Q possibly damaging Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Htr2a C T 14: 74,645,177 T201I possibly damaging Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Klhl29 A T 12: 5,137,542 L274H possibly damaging Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Nek5 C T 8: 22,090,479 probably null Het
Nlrc5 G A 8: 94,525,490 V1880I probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr1318 G A 2: 112,156,629 R226H probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Pccb A T 9: 101,023,252 probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Pik3c2g A T 6: 139,730,366 K79* probably null Het
Pou3f1 C G 4: 124,658,359 A218G possibly damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spdye4a T G 5: 143,225,663 S49R probably benign Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Syt14 A G 1: 192,897,558 S473P probably damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttc17 T C 2: 94,326,704 N411S probably benign Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Usp2 G T 9: 44,075,597 R64L probably benign Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8014:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R9162:Ext1 UTSW 15 53345108 nonsense probably null
R9342:Ext1 UTSW 15 53345128 missense probably benign
R9587:Ext1 UTSW 15 53092412 missense possibly damaging 0.53
R9663:Ext1 UTSW 15 53345060 missense probably damaging 0.96
R9753:Ext1 UTSW 15 53344671 missense probably damaging 1.00
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGGATAGCTGCTCAGATGAG -3'
(R):5'- TGTGCGATGTCTTTTCAACATC -3'

Sequencing Primer
(F):5'- TGAGAAAGAAGGCTTCCTGTC -3'
(R):5'- GCGATGTCTTTTCAACATCATCATTC -3'
Posted On 2021-08-02