Incidental Mutation 'R8889:Rsf1'
ID 677557
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Name remodeling and spacing factor 1
Synonyms p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 97579889-97692778 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 97678964 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1058 (I1058F)
Ref Sequence ENSEMBL: ENSMUSP00000102771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731] [ENSMUST00000135270]
AlphaFold E9PWW9
Predicted Effect
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: I1058F

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123731
Predicted Effect probably benign
Transcript: ENSMUST00000135270
Meta Mutation Damage Score 0.1063 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,386 T47S probably damaging Het
Abca14 T A 7: 120,216,383 L285I probably damaging Het
Abcc2 T G 19: 43,807,132 S442R possibly damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Ank1 T C 8: 23,116,974 L1297P probably damaging Het
Ap3b1 G A 13: 94,542,840 V997M unknown Het
Ash2l T C 8: 25,823,219 K413R probably benign Het
Cacnb1 A T 11: 98,010,366 V220E probably damaging Het
Cacul1 A T 19: 60,580,522 L66Q probably damaging Het
Camkv C T 9: 107,946,134 R120* probably null Het
Ccny T G 18: 9,345,235 S180R probably damaging Het
Cdh23 G T 10: 60,307,505 H3012Q probably damaging Het
Clasp2 T A 9: 113,880,183 L680Q probably damaging Het
Clip1 A T 5: 123,579,502 S1241R probably benign Het
Cthrc1 T A 15: 39,077,050 L16H probably damaging Het
Ctnna1 G A 18: 35,239,533 V514I possibly damaging Het
Ddr1 A C 17: 35,682,664 I852S probably benign Het
Echs1 A C 7: 140,108,118 L258R probably damaging Het
Epha8 G T 4: 136,934,539 H582N probably benign Het
Exph5 G T 9: 53,376,655 G1679W probably damaging Het
Fhod3 G A 18: 25,056,395 probably null Het
Gm10803 G A 2: 93,563,936 D18N unknown Het
Gpr152 T A 19: 4,142,724 I88N probably damaging Het
Gpr179 T C 11: 97,335,764 D1855G possibly damaging Het
H2al2a T A 2: 17,996,788 D29V probably damaging Het
Hnrnpf T G 6: 117,924,792 S346A probably benign Het
Hsd11b2 C T 8: 105,522,631 R213C probably damaging Het
Il17rd A G 14: 27,099,973 D552G possibly damaging Het
Ipo9 T C 1: 135,386,806 N904S possibly damaging Het
Klhl14 T G 18: 21,558,163 T437P possibly damaging Het
Krt5 T C 15: 101,710,750 M268V probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Ltn1 A T 16: 87,432,342 probably benign Het
Macf1 A G 4: 123,355,243 L7165P probably damaging Het
Micall2 T A 5: 139,717,499 H194L probably damaging Het
Mmp16 T A 4: 18,051,820 Y270N probably damaging Het
Nme6 T G 9: 109,839,638 F41V probably damaging Het
Npffr1 A G 10: 61,614,160 N71S possibly damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr409-ps1 T C 11: 74,317,123 W33R probably damaging Het
Pard3b T A 1: 62,637,867 Y1186N probably damaging Het
Pcca A G 14: 122,557,711 probably benign Het
Plekha8 A G 6: 54,615,555 probably benign Het
Ptpn14 T A 1: 189,822,675 L144* probably null Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdx C T 9: 52,086,453 R576C probably damaging Het
Rnf135 C T 11: 80,184,131 T72I probably benign Het
Robo4 G T 9: 37,403,305 R196L probably benign Het
Ryr2 A T 13: 11,785,104 V919E probably damaging Het
Slc39a6 A T 18: 24,596,329 Y442* probably null Het
Slc4a11 T G 2: 130,687,220 S437R probably damaging Het
Slc7a6 T A 8: 106,195,902 V440E probably damaging Het
Sox2 A T 3: 34,650,980 N189Y possibly damaging Het
Spata13 A T 14: 60,756,581 M1161L probably benign Het
Spock3 T A 8: 62,951,952 Y51* probably null Het
Sptbn1 A G 11: 30,117,800 Y1805H probably benign Het
Tcerg1l C T 7: 138,397,531 W41* probably null Het
Tdrd9 A G 12: 112,013,284 Y401C probably benign Het
Tex47 A T 5: 7,305,115 I99F probably damaging Het
Tlr9 G A 9: 106,222,635 probably benign Het
Tmem209 T A 6: 30,497,943 S276C possibly damaging Het
Tmprss11f A C 5: 86,539,759 S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,046,841 probably benign Het
Ttc7 T A 17: 87,330,092 M425K probably damaging Het
Ttn C T 2: 76,909,122 G3737D unknown Het
Unc13b A T 4: 43,176,484 R2437S unknown Het
Uqcrc1 C T 9: 108,937,118 R58C probably damaging Het
Vmn1r128 A G 7: 21,349,815 Y148C possibly damaging Het
Vmn1r193 T C 13: 22,219,669 Y51C probably benign Het
Vmn2r112 A G 17: 22,618,631 Y691C probably damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Vmn2r94 A G 17: 18,244,073 S652P possibly damaging Het
Vps50 T A 6: 3,536,967 C313S probably damaging Het
Vwa5b1 A G 4: 138,610,730 V93A probably benign Het
Xrcc5 T G 1: 72,343,031 D455E possibly damaging Het
Zdhhc6 T A 19: 55,302,555 probably benign Het
Zfp964 G A 8: 69,663,755 G335D probably damaging Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
BB011:Rsf1 UTSW 7 97579909 unclassified probably benign
BB014:Rsf1 UTSW 7 97579924 unclassified probably benign
BB018:Rsf1 UTSW 7 97579909 unclassified probably benign
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
G1Funyon:Rsf1 UTSW 7 97661925 missense
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1928:Rsf1 UTSW 7 97579909 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
R7352:Rsf1 UTSW 7 97579926 unclassified probably benign
R7380:Rsf1 UTSW 7 97579915 unclassified probably benign
R7393:Rsf1 UTSW 7 97579917 unclassified probably benign
R7395:Rsf1 UTSW 7 97579926 unclassified probably benign
R7411:Rsf1 UTSW 7 97579932 unclassified probably benign
R7413:Rsf1 UTSW 7 97579921 unclassified probably benign
R7481:Rsf1 UTSW 7 97579917 unclassified probably benign
R7538:Rsf1 UTSW 7 97579906 unclassified probably benign
R7541:Rsf1 UTSW 7 97579911 unclassified probably benign
R7545:Rsf1 UTSW 7 97579927 unclassified probably benign
R7574:Rsf1 UTSW 7 97661167 missense
R7578:Rsf1 UTSW 7 97579932 unclassified probably benign
R7599:Rsf1 UTSW 7 97579904 unclassified probably benign
R7630:Rsf1 UTSW 7 97579906 unclassified probably benign
R7632:Rsf1 UTSW 7 97579906 unclassified probably benign
R7710:Rsf1 UTSW 7 97681834 missense
R7711:Rsf1 UTSW 7 97579909 unclassified probably benign
R7715:Rsf1 UTSW 7 97579912 unclassified probably benign
R7719:Rsf1 UTSW 7 97579906 unclassified probably benign
R7722:Rsf1 UTSW 7 97579906 unclassified probably benign
R7729:Rsf1 UTSW 7 97579911 unclassified probably benign
R7734:Rsf1 UTSW 7 97579908 unclassified probably benign
R7743:Rsf1 UTSW 7 97579932 unclassified probably benign
R7761:Rsf1 UTSW 7 97579920 unclassified probably benign
R7764:Rsf1 UTSW 7 97579927 unclassified probably benign
R7797:Rsf1 UTSW 7 97661485 missense
R7802:Rsf1 UTSW 7 97661772 missense
R7806:Rsf1 UTSW 7 97579920 unclassified probably benign
R7821:Rsf1 UTSW 7 97579906 unclassified probably benign
R7823:Rsf1 UTSW 7 97579907 unclassified probably benign
R7824:Rsf1 UTSW 7 97579908 unclassified probably benign
R7825:Rsf1 UTSW 7 97579909 unclassified probably benign
R7826:Rsf1 UTSW 7 97661161 unclassified probably benign
R7841:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R7854:Rsf1 UTSW 7 97579924 unclassified probably benign
R7862:Rsf1 UTSW 7 97579923 unclassified probably benign
R7893:Rsf1 UTSW 7 97661958 missense
R7923:Rsf1 UTSW 7 97579906 unclassified probably benign
R7924:Rsf1 UTSW 7 97579909 unclassified probably benign
R7927:Rsf1 UTSW 7 97579924 unclassified probably benign
R7931:Rsf1 UTSW 7 97579909 unclassified probably benign
R7951:Rsf1 UTSW 7 97579912 unclassified probably benign
R7957:Rsf1 UTSW 7 97579906 unclassified probably benign
R7960:Rsf1 UTSW 7 97579917 unclassified probably benign
R7979:Rsf1 UTSW 7 97685713 missense
R7982:Rsf1 UTSW 7 97579932 unclassified probably benign
R7991:Rsf1 UTSW 7 97661333 missense
R8028:Rsf1 UTSW 7 97579908 unclassified probably benign
R8030:Rsf1 UTSW 7 97579909 unclassified probably benign
R8042:Rsf1 UTSW 7 97579909 unclassified probably benign
R8062:Rsf1 UTSW 7 97677387 missense
R8076:Rsf1 UTSW 7 97579904 unclassified probably benign
R8117:Rsf1 UTSW 7 97639257 splice site probably null
R8132:Rsf1 UTSW 7 97579908 unclassified probably benign
R8153:Rsf1 UTSW 7 97579906 unclassified probably benign
R8155:Rsf1 UTSW 7 97579907 unclassified probably benign
R8166:Rsf1 UTSW 7 97579909 unclassified probably benign
R8197:Rsf1 UTSW 7 97579914 unclassified probably benign
R8235:Rsf1 UTSW 7 97676254 utr 3 prime probably benign
R8245:Rsf1 UTSW 7 97579915 unclassified probably benign
R8282:Rsf1 UTSW 7 97579920 frame shift probably null
R8301:Rsf1 UTSW 7 97661925 missense
R8315:Rsf1 UTSW 7 97579923 unclassified probably benign
R8343:Rsf1 UTSW 7 97579904 unclassified probably benign
R8370:Rsf1 UTSW 7 97579929 unclassified probably benign
R8372:Rsf1 UTSW 7 97662417 missense
R8376:Rsf1 UTSW 7 97579917 unclassified probably benign
R8382:Rsf1 UTSW 7 97579917 unclassified probably benign
R8392:Rsf1 UTSW 7 97579909 unclassified probably benign
R8410:Rsf1 UTSW 7 97579917 unclassified probably benign
R8443:Rsf1 UTSW 7 97616896 missense
R8502:Rsf1 UTSW 7 97579914 unclassified probably benign
R8529:Rsf1 UTSW 7 97670867 utr 3 prime probably benign
R8537:Rsf1 UTSW 7 97579914 unclassified probably benign
R8554:Rsf1 UTSW 7 97579923 unclassified probably benign
R8558:Rsf1 UTSW 7 97579907 unclassified probably benign
R8735:Rsf1 UTSW 7 97579907 unclassified probably benign
R8742:Rsf1 UTSW 7 97579914 unclassified probably benign
R8772:Rsf1 UTSW 7 97579908 unclassified probably benign
R8862:Rsf1 UTSW 7 97579907 unclassified probably benign
R8866:Rsf1 UTSW 7 97579913 unclassified probably benign
R8889:Rsf1 UTSW 7 97579909 unclassified probably benign
R8891:Rsf1 UTSW 7 97579909 unclassified probably benign
R8892:Rsf1 UTSW 7 97678964 missense
R8907:Rsf1 UTSW 7 97579906 unclassified probably benign
R8907:Rsf1 UTSW 7 97579918 unclassified probably benign
R8913:Rsf1 UTSW 7 97579906 unclassified probably benign
R8916:Rsf1 UTSW 7 97579933 unclassified probably benign
R8924:Rsf1 UTSW 7 97579907 unclassified probably benign
R8940:Rsf1 UTSW 7 97579906 unclassified probably benign
R8946:Rsf1 UTSW 7 97579906 unclassified probably benign
R8947:Rsf1 UTSW 7 97681852 unclassified probably benign
R8951:Rsf1 UTSW 7 97579904 unclassified probably benign
R8975:Rsf1 UTSW 7 97579908 unclassified probably benign
R9033:Rsf1 UTSW 7 97579904 unclassified probably benign
R9044:Rsf1 UTSW 7 97579904 unclassified probably benign
R9060:Rsf1 UTSW 7 97579923 unclassified probably benign
R9066:Rsf1 UTSW 7 97579911 unclassified probably benign
R9079:Rsf1 UTSW 7 97579904 unclassified probably benign
R9080:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R9094:Rsf1 UTSW 7 97579909 unclassified probably benign
R9096:Rsf1 UTSW 7 97579907 unclassified probably benign
R9101:Rsf1 UTSW 7 97579907 unclassified probably benign
R9102:Rsf1 UTSW 7 97579931 unclassified probably benign
R9123:Rsf1 UTSW 7 97579909 unclassified probably benign
R9125:Rsf1 UTSW 7 97579908 unclassified probably benign
R9126:Rsf1 UTSW 7 97579908 unclassified probably benign
R9128:Rsf1 UTSW 7 97579909 unclassified probably benign
R9157:Rsf1 UTSW 7 97579906 unclassified probably benign
R9158:Rsf1 UTSW 7 97579929 unclassified probably benign
R9159:Rsf1 UTSW 7 97579908 unclassified probably benign
R9161:Rsf1 UTSW 7 97579906 unclassified probably benign
R9168:Rsf1 UTSW 7 97579917 unclassified probably benign
R9187:Rsf1 UTSW 7 97579933 unclassified probably benign
R9207:Rsf1 UTSW 7 97579926 unclassified probably benign
R9240:Rsf1 UTSW 7 97579912 unclassified probably benign
R9250:Rsf1 UTSW 7 97579914 unclassified probably benign
R9257:Rsf1 UTSW 7 97685711 missense
R9275:Rsf1 UTSW 7 97579923 unclassified probably benign
R9277:Rsf1 UTSW 7 97579917 unclassified probably benign
R9288:Rsf1 UTSW 7 97579912 unclassified probably benign
R9341:Rsf1 UTSW 7 97579924 unclassified probably benign
R9345:Rsf1 UTSW 7 97579932 unclassified probably benign
R9406:Rsf1 UTSW 7 97579911 unclassified probably benign
R9411:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R9414:Rsf1 UTSW 7 97664558 critical splice acceptor site probably null
R9420:Rsf1 UTSW 7 97579927 unclassified probably benign
R9421:Rsf1 UTSW 7 97579934 unclassified probably benign
R9423:Rsf1 UTSW 7 97579909 unclassified probably benign
R9427:Rsf1 UTSW 7 97579909 unclassified probably benign
R9448:Rsf1 UTSW 7 97579909 unclassified probably benign
R9452:Rsf1 UTSW 7 97579926 unclassified probably benign
R9454:Rsf1 UTSW 7 97579923 unclassified probably benign
R9467:Rsf1 UTSW 7 97579913 unclassified probably benign
R9468:Rsf1 UTSW 7 97579920 unclassified probably benign
RF034:Rsf1 UTSW 7 97579908 unclassified probably benign
RF036:Rsf1 UTSW 7 97579908 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGTCTCTGCCTTGTAAACTTG -3'
(R):5'- CACACACCCGTCACTGATCTTG -3'

Sequencing Primer
(F):5'- AGAGAGGCACAGTAATCCTTTC -3'
(R):5'- ACACCCGTCACTGATCTTGAATTC -3'
Posted On 2021-08-02