Incidental Mutation 'R8889:Abca14'
ID 677558
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 068693-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119815606 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 285 (L285I)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably damaging
Transcript: ENSMUST00000084640
AA Change: L285I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: L285I

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,795,571 (GRCm39) S442R possibly damaging Het
Adgrl3 A T 5: 81,874,516 (GRCm39) I938F probably damaging Het
Ank1 T C 8: 23,606,990 (GRCm39) L1297P probably damaging Het
Ap3b1 G A 13: 94,679,348 (GRCm39) V997M unknown Het
Ash2l T C 8: 26,313,247 (GRCm39) K413R probably benign Het
Cacnb1 A T 11: 97,901,192 (GRCm39) V220E probably damaging Het
Cacul1 A T 19: 60,568,960 (GRCm39) L66Q probably damaging Het
Camkv C T 9: 107,823,333 (GRCm39) R120* probably null Het
Ccny T G 18: 9,345,235 (GRCm39) S180R probably damaging Het
Cdh23 G T 10: 60,143,284 (GRCm39) H3012Q probably damaging Het
Clasp2 T A 9: 113,709,251 (GRCm39) L680Q probably damaging Het
Clip1 A T 5: 123,717,565 (GRCm39) S1241R probably benign Het
Cthrc1 T A 15: 38,940,445 (GRCm39) L16H probably damaging Het
Ctnna1 G A 18: 35,372,586 (GRCm39) V514I possibly damaging Het
Ddr1 A C 17: 35,993,556 (GRCm39) I852S probably benign Het
Echs1 A C 7: 139,688,031 (GRCm39) L258R probably damaging Het
Epha8 G T 4: 136,661,850 (GRCm39) H582N probably benign Het
Exph5 G T 9: 53,287,955 (GRCm39) G1679W probably damaging Het
Fhod3 G A 18: 25,189,452 (GRCm39) probably null Het
Gm10803 G A 2: 93,394,281 (GRCm39) D18N unknown Het
Gpr152 T A 19: 4,192,723 (GRCm39) I88N probably damaging Het
Gpr179 T C 11: 97,226,590 (GRCm39) D1855G possibly damaging Het
H2al2a T A 2: 18,001,599 (GRCm39) D29V probably damaging Het
Hnrnpf T G 6: 117,901,753 (GRCm39) S346A probably benign Het
Hsd11b2 C T 8: 106,249,263 (GRCm39) R213C probably damaging Het
Il17rd A G 14: 26,821,930 (GRCm39) D552G possibly damaging Het
Ipo9 T C 1: 135,314,544 (GRCm39) N904S possibly damaging Het
Klhl14 T G 18: 21,691,220 (GRCm39) T437P possibly damaging Het
Krt5 T C 15: 101,619,185 (GRCm39) M268V probably benign Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Ltn1 A T 16: 87,229,230 (GRCm39) probably benign Het
Macf1 A G 4: 123,249,036 (GRCm39) L7165P probably damaging Het
Micall2 T A 5: 139,703,254 (GRCm39) H194L probably damaging Het
Mmp16 T A 4: 18,051,820 (GRCm39) Y270N probably damaging Het
Nme6 T G 9: 109,668,706 (GRCm39) F41V probably damaging Het
Npffr1 A G 10: 61,449,939 (GRCm39) N71S possibly damaging Het
Or1p4-ps1 T C 11: 74,207,949 (GRCm39) W33R probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Pard3b T A 1: 62,677,026 (GRCm39) Y1186N probably damaging Het
Pate5 T A 9: 35,750,682 (GRCm39) T47S probably damaging Het
Pcca A G 14: 122,795,123 (GRCm39) probably benign Het
Plekha8 A G 6: 54,592,540 (GRCm39) probably benign Het
Ptpn14 T A 1: 189,554,872 (GRCm39) L144* probably null Het
Rad52 C T 6: 119,890,041 (GRCm39) R56C probably damaging Het
Rdx C T 9: 51,997,753 (GRCm39) R576C probably damaging Het
Rnf135 C T 11: 80,074,957 (GRCm39) T72I probably benign Het
Robo4 G T 9: 37,314,601 (GRCm39) R196L probably benign Het
Rsf1 G GACGTCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Rsf1 A T 7: 97,328,171 (GRCm39) I1058F Het
Ryr2 A T 13: 11,799,990 (GRCm39) V919E probably damaging Het
Slc39a6 A T 18: 24,729,386 (GRCm39) Y442* probably null Het
Slc4a11 T G 2: 130,529,140 (GRCm39) S437R probably damaging Het
Slc7a6 T A 8: 106,922,534 (GRCm39) V440E probably damaging Het
Sox2 A T 3: 34,705,129 (GRCm39) N189Y possibly damaging Het
Spata13 A T 14: 60,994,030 (GRCm39) M1161L probably benign Het
Spock3 T A 8: 63,404,986 (GRCm39) Y51* probably null Het
Sptbn1 A G 11: 30,067,800 (GRCm39) Y1805H probably benign Het
Tcerg1l C T 7: 137,999,260 (GRCm39) W41* probably null Het
Tdrd9 A G 12: 111,979,718 (GRCm39) Y401C probably benign Het
Tex47 A T 5: 7,355,115 (GRCm39) I99F probably damaging Het
Tlr9 G A 9: 106,099,834 (GRCm39) probably benign Het
Tmem209 T A 6: 30,497,942 (GRCm39) S276C possibly damaging Het
Tmprss11f A C 5: 86,687,618 (GRCm39) S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,179,908 (GRCm39) probably benign Het
Ttc7 T A 17: 87,637,520 (GRCm39) M425K probably damaging Het
Ttn C T 2: 76,739,466 (GRCm39) G3737D unknown Het
Unc13b A T 4: 43,176,484 (GRCm39) R2437S unknown Het
Uqcrc1 C T 9: 108,766,186 (GRCm39) R58C probably damaging Het
Vmn1r128 A G 7: 21,083,740 (GRCm39) Y148C possibly damaging Het
Vmn1r193 T C 13: 22,403,839 (GRCm39) Y51C probably benign Het
Vmn2r112 A G 17: 22,837,612 (GRCm39) Y691C probably damaging Het
Vmn2r25 T A 6: 123,800,569 (GRCm39) D591V probably damaging Het
Vmn2r94 A G 17: 18,464,335 (GRCm39) S652P possibly damaging Het
Vps50 T A 6: 3,536,967 (GRCm39) C313S probably damaging Het
Vwa5b1 A G 4: 138,338,041 (GRCm39) V93A probably benign Het
Xrcc5 T G 1: 72,382,190 (GRCm39) D455E possibly damaging Het
Zdhhc6 T A 19: 55,290,987 (GRCm39) probably benign Het
Zfp964 G A 8: 70,116,405 (GRCm39) G335D probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCATTCAGTAGACAAGGC -3'
(R):5'- AAAGCCTCAGAAAATTGATCGTTGG -3'

Sequencing Primer
(F):5'- GCCATCATGATGTATCACAGTGGC -3'
(R):5'- CTCAGAAAATTGATCGTTGGCCCTG -3'
Posted On 2021-08-02