Incidental Mutation 'R8889:Rdx'
ID 677569
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 068693-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 51997753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 576 (R576C)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably damaging
Transcript: ENSMUST00000000590
AA Change: R576C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: R576C

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163153
AA Change: R576C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: R576C

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Meta Mutation Damage Score 0.9115 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,815,606 (GRCm39) L285I probably damaging Het
Abcc2 T G 19: 43,795,571 (GRCm39) S442R possibly damaging Het
Adgrl3 A T 5: 81,874,516 (GRCm39) I938F probably damaging Het
Ank1 T C 8: 23,606,990 (GRCm39) L1297P probably damaging Het
Ap3b1 G A 13: 94,679,348 (GRCm39) V997M unknown Het
Ash2l T C 8: 26,313,247 (GRCm39) K413R probably benign Het
Cacnb1 A T 11: 97,901,192 (GRCm39) V220E probably damaging Het
Cacul1 A T 19: 60,568,960 (GRCm39) L66Q probably damaging Het
Camkv C T 9: 107,823,333 (GRCm39) R120* probably null Het
Ccny T G 18: 9,345,235 (GRCm39) S180R probably damaging Het
Cdh23 G T 10: 60,143,284 (GRCm39) H3012Q probably damaging Het
Clasp2 T A 9: 113,709,251 (GRCm39) L680Q probably damaging Het
Clip1 A T 5: 123,717,565 (GRCm39) S1241R probably benign Het
Cthrc1 T A 15: 38,940,445 (GRCm39) L16H probably damaging Het
Ctnna1 G A 18: 35,372,586 (GRCm39) V514I possibly damaging Het
Ddr1 A C 17: 35,993,556 (GRCm39) I852S probably benign Het
Echs1 A C 7: 139,688,031 (GRCm39) L258R probably damaging Het
Epha8 G T 4: 136,661,850 (GRCm39) H582N probably benign Het
Exph5 G T 9: 53,287,955 (GRCm39) G1679W probably damaging Het
Fhod3 G A 18: 25,189,452 (GRCm39) probably null Het
Gm10803 G A 2: 93,394,281 (GRCm39) D18N unknown Het
Gpr152 T A 19: 4,192,723 (GRCm39) I88N probably damaging Het
Gpr179 T C 11: 97,226,590 (GRCm39) D1855G possibly damaging Het
H2al2a T A 2: 18,001,599 (GRCm39) D29V probably damaging Het
Hnrnpf T G 6: 117,901,753 (GRCm39) S346A probably benign Het
Hsd11b2 C T 8: 106,249,263 (GRCm39) R213C probably damaging Het
Il17rd A G 14: 26,821,930 (GRCm39) D552G possibly damaging Het
Ipo9 T C 1: 135,314,544 (GRCm39) N904S possibly damaging Het
Klhl14 T G 18: 21,691,220 (GRCm39) T437P possibly damaging Het
Krt5 T C 15: 101,619,185 (GRCm39) M268V probably benign Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Ltn1 A T 16: 87,229,230 (GRCm39) probably benign Het
Macf1 A G 4: 123,249,036 (GRCm39) L7165P probably damaging Het
Micall2 T A 5: 139,703,254 (GRCm39) H194L probably damaging Het
Mmp16 T A 4: 18,051,820 (GRCm39) Y270N probably damaging Het
Nme6 T G 9: 109,668,706 (GRCm39) F41V probably damaging Het
Npffr1 A G 10: 61,449,939 (GRCm39) N71S possibly damaging Het
Or1p4-ps1 T C 11: 74,207,949 (GRCm39) W33R probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Pard3b T A 1: 62,677,026 (GRCm39) Y1186N probably damaging Het
Pate5 T A 9: 35,750,682 (GRCm39) T47S probably damaging Het
Pcca A G 14: 122,795,123 (GRCm39) probably benign Het
Plekha8 A G 6: 54,592,540 (GRCm39) probably benign Het
Ptpn14 T A 1: 189,554,872 (GRCm39) L144* probably null Het
Rad52 C T 6: 119,890,041 (GRCm39) R56C probably damaging Het
Rnf135 C T 11: 80,074,957 (GRCm39) T72I probably benign Het
Robo4 G T 9: 37,314,601 (GRCm39) R196L probably benign Het
Rsf1 G GACGTCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Rsf1 A T 7: 97,328,171 (GRCm39) I1058F Het
Ryr2 A T 13: 11,799,990 (GRCm39) V919E probably damaging Het
Slc39a6 A T 18: 24,729,386 (GRCm39) Y442* probably null Het
Slc4a11 T G 2: 130,529,140 (GRCm39) S437R probably damaging Het
Slc7a6 T A 8: 106,922,534 (GRCm39) V440E probably damaging Het
Sox2 A T 3: 34,705,129 (GRCm39) N189Y possibly damaging Het
Spata13 A T 14: 60,994,030 (GRCm39) M1161L probably benign Het
Spock3 T A 8: 63,404,986 (GRCm39) Y51* probably null Het
Sptbn1 A G 11: 30,067,800 (GRCm39) Y1805H probably benign Het
Tcerg1l C T 7: 137,999,260 (GRCm39) W41* probably null Het
Tdrd9 A G 12: 111,979,718 (GRCm39) Y401C probably benign Het
Tex47 A T 5: 7,355,115 (GRCm39) I99F probably damaging Het
Tlr9 G A 9: 106,099,834 (GRCm39) probably benign Het
Tmem209 T A 6: 30,497,942 (GRCm39) S276C possibly damaging Het
Tmprss11f A C 5: 86,687,618 (GRCm39) S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,179,908 (GRCm39) probably benign Het
Ttc7 T A 17: 87,637,520 (GRCm39) M425K probably damaging Het
Ttn C T 2: 76,739,466 (GRCm39) G3737D unknown Het
Unc13b A T 4: 43,176,484 (GRCm39) R2437S unknown Het
Uqcrc1 C T 9: 108,766,186 (GRCm39) R58C probably damaging Het
Vmn1r128 A G 7: 21,083,740 (GRCm39) Y148C possibly damaging Het
Vmn1r193 T C 13: 22,403,839 (GRCm39) Y51C probably benign Het
Vmn2r112 A G 17: 22,837,612 (GRCm39) Y691C probably damaging Het
Vmn2r25 T A 6: 123,800,569 (GRCm39) D591V probably damaging Het
Vmn2r94 A G 17: 18,464,335 (GRCm39) S652P possibly damaging Het
Vps50 T A 6: 3,536,967 (GRCm39) C313S probably damaging Het
Vwa5b1 A G 4: 138,338,041 (GRCm39) V93A probably benign Het
Xrcc5 T G 1: 72,382,190 (GRCm39) D455E possibly damaging Het
Zdhhc6 T A 19: 55,290,987 (GRCm39) probably benign Het
Zfp964 G A 8: 70,116,405 (GRCm39) G335D probably damaging Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9226:Rdx UTSW 9 51,992,468 (GRCm39) missense probably benign 0.01
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGCTTGCATACCAGCCAG -3'
(R):5'- CCTTCAGTGTCCTGCTAGTGAG -3'

Sequencing Primer
(F):5'- GCCAGAAAAACATTCCACAGTGG -3'
(R):5'- CGACTGGTATGAGTGCTT -3'
Posted On 2021-08-02