Mutagenetix > Incidental Mutations

Incidental Mutation 'R8889:Tlr9'

677571

Institutional Source

Beutler Lab

Gene Symbol

Tlr9

Ensembl Gene

ENSMUSG00000045322

Gene Name

toll-like receptor 9

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R8889 (G1)

Quality Score

183.009

Status

Validated

Chromosome

Chromosomal Location

106222598-106226883 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to A at 106222635 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000082207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062241]

AlphaFold

Q9EQU3

PDB Structure

Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000062241

SMART Domains

Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRR	62	85	1.49e2	SMART
LRR	122	144	1.41e1	SMART
LRR	198	221	4.98e-1	SMART
LRR	283	306	6.59e1	SMART
LRR	307	332	1.62e1	SMART
Blast:LRR	333	361	8e-6	BLAST
LRR	390	413	7.38e1	SMART
LRR	414	440	1.86e2	SMART
LRR	496	520	1.81e2	SMART
LRR	521	544	6.05e0	SMART
LRR	545	568	2.27e2	SMART
LRR	575	599	4.58e1	SMART
LRR	628	651	3.87e1	SMART
LRR_TYP	677	700	3.39e-3	SMART
LRR	702	724	2.27e2	SMART
LRR	726	748	3.09e2	SMART
Blast:LRRCT	761	810	4e-11	BLAST
Pfam:TIR	870	1029	7.4e-11	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	T	A	9: 35,839,386	T47S	probably damaging	Het
Abca14	T	A	7: 120,216,383	L285I	probably damaging	Het
Abcc2	T	G	19: 43,807,132	S442R	possibly damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Ank1	T	C	8: 23,116,974	L1297P	probably damaging	Het
Ap3b1	G	A	13: 94,542,840	V997M	unknown	Het
Ash2l	T	C	8: 25,823,219	K413R	probably benign	Het
Cacnb1	A	T	11: 98,010,366	V220E	probably damaging	Het
Cacul1	A	T	19: 60,580,522	L66Q	probably damaging	Het
Camkv	C	T	9: 107,946,134	R120*	probably null	Het
Ccny	T	G	18: 9,345,235	S180R	probably damaging	Het
Cdh23	G	T	10: 60,307,505	H3012Q	probably damaging	Het
Clasp2	T	A	9: 113,880,183	L680Q	probably damaging	Het
Clip1	A	T	5: 123,579,502	S1241R	probably benign	Het
Cthrc1	T	A	15: 39,077,050	L16H	probably damaging	Het
Ctnna1	G	A	18: 35,239,533	V514I	possibly damaging	Het
Ddr1	A	C	17: 35,682,664	I852S	probably benign	Het
Echs1	A	C	7: 140,108,118	L258R	probably damaging	Het
Epha8	G	T	4: 136,934,539	H582N	probably benign	Het
Exph5	G	T	9: 53,376,655	G1679W	probably damaging	Het
Fhod3	G	A	18: 25,056,395		probably null	Het
Gm10803	G	A	2: 93,563,936	D18N	unknown	Het
Gpr152	T	A	19: 4,142,724	I88N	probably damaging	Het
Gpr179	T	C	11: 97,335,764	D1855G	possibly damaging	Het
H2al2a	T	A	2: 17,996,788	D29V	probably damaging	Het
Hnrnpf	T	G	6: 117,924,792	S346A	probably benign	Het
Hsd11b2	C	T	8: 105,522,631	R213C	probably damaging	Het
Il17rd	A	G	14: 27,099,973	D552G	possibly damaging	Het
Ipo9	T	C	1: 135,386,806	N904S	possibly damaging	Het
Klhl14	T	G	18: 21,558,163	T437P	possibly damaging	Het
Krt5	T	C	15: 101,710,750	M268V	probably benign	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Ltn1	A	T	16: 87,432,342		probably benign	Het
Macf1	A	G	4: 123,355,243	L7165P	probably damaging	Het
Micall2	T	A	5: 139,717,499	H194L	probably damaging	Het
Mmp16	T	A	4: 18,051,820	Y270N	probably damaging	Het
Nme6	T	G	9: 109,839,638	F41V	probably damaging	Het
Npffr1	A	G	10: 61,614,160	N71S	possibly damaging	Het
Olfr1287	A	G	2: 111,449,622	I161V	probably benign	Het
Olfr409-ps1	T	C	11: 74,317,123	W33R	probably damaging	Het
Pard3b	T	A	1: 62,637,867	Y1186N	probably damaging	Het
Pcca	A	G	14: 122,557,711		probably benign	Het
Plekha8	A	G	6: 54,615,555		probably benign	Het
Ptpn14	T	A	1: 189,822,675	L144*	probably null	Het
Rad52	C	T	6: 119,913,080	R56C	probably damaging	Het
Rdx	C	T	9: 52,086,453	R576C	probably damaging	Het
Rnf135	C	T	11: 80,184,131	T72I	probably benign	Het
Robo4	G	T	9: 37,403,305	R196L	probably benign	Het
Rsf1	G	GACGTCGGCT	7: 97,579,909		probably benign	Het
Rsf1	A	T	7: 97,678,964	I1058F		Het
Ryr2	A	T	13: 11,785,104	V919E	probably damaging	Het
Slc39a6	A	T	18: 24,596,329	Y442*	probably null	Het
Slc4a11	T	G	2: 130,687,220	S437R	probably damaging	Het
Slc7a6	T	A	8: 106,195,902	V440E	probably damaging	Het
Sox2	A	T	3: 34,650,980	N189Y	possibly damaging	Het
Spata13	A	T	14: 60,756,581	M1161L	probably benign	Het
Spock3	T	A	8: 62,951,952	Y51*	probably null	Het
Sptbn1	A	G	11: 30,117,800	Y1805H	probably benign	Het
Tcerg1l	C	T	7: 138,397,531	W41*	probably null	Het
Tdrd9	A	G	12: 112,013,284	Y401C	probably benign	Het
Tex47	A	T	5: 7,305,115	I99F	probably damaging	Het
Tmem209	T	A	6: 30,497,943	S276C	possibly damaging	Het
Tmprss11f	A	C	5: 86,539,759	S97A	possibly damaging	Het
Tnfaip8	ACACACTC	AC	18: 50,046,841		probably benign	Het
Ttc7	T	A	17: 87,330,092	M425K	probably damaging	Het
Ttn	C	T	2: 76,909,122	G3737D	unknown	Het
Unc13b	A	T	4: 43,176,484	R2437S	unknown	Het
Uqcrc1	C	T	9: 108,937,118	R58C	probably damaging	Het
Vmn1r128	A	G	7: 21,349,815	Y148C	possibly damaging	Het
Vmn1r193	T	C	13: 22,219,669	Y51C	probably benign	Het
Vmn2r112	A	G	17: 22,618,631	Y691C	probably damaging	Het
Vmn2r25	T	A	6: 123,823,610	D591V	probably damaging	Het
Vmn2r94	A	G	17: 18,244,073	S652P	possibly damaging	Het
Vps50	T	A	6: 3,536,967	C313S	probably damaging	Het
Vwa5b1	A	G	4: 138,610,730	V93A	probably benign	Het
Xrcc5	T	G	1: 72,343,031	D455E	possibly damaging	Het
Zdhhc6	T	A	19: 55,302,555		probably benign	Het
Zfp964	G	A	8: 69,663,755	G335D	probably damaging	Het

Other mutations in Tlr9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Tlr9	APN	9	106225007	missense	probably damaging	1.00
IGL01764:Tlr9	APN	9	106225805	missense	probably damaging	1.00
IGL02077:Tlr9	APN	9	106225505	missense	possibly damaging	0.90
IGL02232:Tlr9	APN	9	106224937	missense	probably damaging	1.00
IGL02851:Tlr9	APN	9	106224730	nonsense	probably null
Asura	UTSW	9	106224647	missense	probably damaging	1.00
Cpg1	UTSW	9	106225007	missense	probably damaging	1.00
Cpg11	UTSW	9	106224586	missense	probably damaging	1.00
Cpg2	UTSW	9	106226465	missense	probably damaging	1.00
Cpg3	UTSW	9	106224152	missense	probably damaging	1.00
Cpg5	UTSW	9	106224689	missense	probably damaging	1.00
Cpg6	UTSW	9	106226593	missense	probably damaging	1.00
cpg7	UTSW	9	106225349	missense	probably benign	0.00
Meager	UTSW	9	106224139	missense	probably damaging	1.00
PIT4498001:Tlr9	UTSW	9	106223522	missense	probably benign	0.00
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0058:Tlr9	UTSW	9	106224965	missense	possibly damaging	0.90
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0071:Tlr9	UTSW	9	106223578	missense	probably benign
R0126:Tlr9	UTSW	9	106225682	missense	probably benign	0.01
R0165:Tlr9	UTSW	9	106226087	missense	probably benign	0.10
R0534:Tlr9	UTSW	9	106224887	missense	probably benign	0.01
R0585:Tlr9	UTSW	9	106225076	missense	probably benign	0.01
R1527:Tlr9	UTSW	9	106223750	missense	probably benign	0.09
R1712:Tlr9	UTSW	9	106224049	missense	probably damaging	1.00
R1817:Tlr9	UTSW	9	106224943	missense	probably benign
R1940:Tlr9	UTSW	9	106224647	missense	probably damaging	1.00
R2117:Tlr9	UTSW	9	106225337	missense	probably damaging	1.00
R2656:Tlr9	UTSW	9	106223941	missense	probably benign	0.05
R3700:Tlr9	UTSW	9	106224079	missense	probably damaging	1.00
R4600:Tlr9	UTSW	9	106224533	missense	probably damaging	1.00
R4608:Tlr9	UTSW	9	106224974	missense	probably damaging	0.99
R4612:Tlr9	UTSW	9	106223807	missense	probably damaging	1.00
R4959:Tlr9	UTSW	9	106224677	missense	probably benign
R5173:Tlr9	UTSW	9	106225952	missense	possibly damaging	0.49
R5472:Tlr9	UTSW	9	106224313	missense	probably damaging	1.00
R5572:Tlr9	UTSW	9	106225637	missense	possibly damaging	0.47
R5618:Tlr9	UTSW	9	106224739	missense	possibly damaging	0.47
R5820:Tlr9	UTSW	9	106222707	critical splice donor site	probably null
R6393:Tlr9	UTSW	9	106224937	missense	probably damaging	1.00
R6397:Tlr9	UTSW	9	106225106	missense	probably damaging	1.00
R6455:Tlr9	UTSW	9	106223999	missense	probably damaging	1.00
R7385:Tlr9	UTSW	9	106225264	missense	probably damaging	1.00
R7455:Tlr9	UTSW	9	106224530	missense	probably benign	0.00
R7561:Tlr9	UTSW	9	106225949	missense	probably benign	0.00
R8892:Tlr9	UTSW	9	106222635	start gained	probably benign
R8926:Tlr9	UTSW	9	106226014	missense	probably benign
R9221:Tlr9	UTSW	9	106224773	missense	probably damaging	1.00
R9228:Tlr9	UTSW	9	106225553	missense	possibly damaging	0.49
Z1176:Tlr9	UTSW	9	106223663	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGCATATGTGATACCCTTTGGC -3'
(R):5'- AGCAGGTTCAACTCTCTGCTC -3'

Sequencing Primer
(F):5'- CATATGTGATACCCTTTGGCTGATTG -3'
(R):5'- TCAACTCTCTGCTCAGGGGATG -3'

Posted On

2021-08-02