Incidental Mutation 'R8889:Uqcrc1'
ID 677573
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Name ubiquinol-cytochrome c reductase core protein 1
Synonyms 1110032G10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108936633-108949623 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108937118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 58 (R58C)
Ref Sequence ENSEMBL: ENSMUSP00000026743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000195738]
AlphaFold Q9CZ13
Predicted Effect probably damaging
Transcript: ENSMUST00000026743
AA Change: R58C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: R58C

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000194047
AA Change: R41C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651
AA Change: R41C

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Meta Mutation Damage Score 0.8018 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik T A 9: 35,839,386 T47S probably damaging Het
Abca14 T A 7: 120,216,383 L285I probably damaging Het
Abcc2 T G 19: 43,807,132 S442R possibly damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Ank1 T C 8: 23,116,974 L1297P probably damaging Het
Ap3b1 G A 13: 94,542,840 V997M unknown Het
Ash2l T C 8: 25,823,219 K413R probably benign Het
Cacnb1 A T 11: 98,010,366 V220E probably damaging Het
Cacul1 A T 19: 60,580,522 L66Q probably damaging Het
Camkv C T 9: 107,946,134 R120* probably null Het
Ccny T G 18: 9,345,235 S180R probably damaging Het
Cdh23 G T 10: 60,307,505 H3012Q probably damaging Het
Clasp2 T A 9: 113,880,183 L680Q probably damaging Het
Clip1 A T 5: 123,579,502 S1241R probably benign Het
Cthrc1 T A 15: 39,077,050 L16H probably damaging Het
Ctnna1 G A 18: 35,239,533 V514I possibly damaging Het
Ddr1 A C 17: 35,682,664 I852S probably benign Het
Echs1 A C 7: 140,108,118 L258R probably damaging Het
Epha8 G T 4: 136,934,539 H582N probably benign Het
Exph5 G T 9: 53,376,655 G1679W probably damaging Het
Fhod3 G A 18: 25,056,395 probably null Het
Gm10803 G A 2: 93,563,936 D18N unknown Het
Gpr152 T A 19: 4,142,724 I88N probably damaging Het
Gpr179 T C 11: 97,335,764 D1855G possibly damaging Het
H2al2a T A 2: 17,996,788 D29V probably damaging Het
Hnrnpf T G 6: 117,924,792 S346A probably benign Het
Hsd11b2 C T 8: 105,522,631 R213C probably damaging Het
Il17rd A G 14: 27,099,973 D552G possibly damaging Het
Ipo9 T C 1: 135,386,806 N904S possibly damaging Het
Klhl14 T G 18: 21,558,163 T437P possibly damaging Het
Krt5 T C 15: 101,710,750 M268V probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Ltn1 A T 16: 87,432,342 probably benign Het
Macf1 A G 4: 123,355,243 L7165P probably damaging Het
Micall2 T A 5: 139,717,499 H194L probably damaging Het
Mmp16 T A 4: 18,051,820 Y270N probably damaging Het
Nme6 T G 9: 109,839,638 F41V probably damaging Het
Npffr1 A G 10: 61,614,160 N71S possibly damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr409-ps1 T C 11: 74,317,123 W33R probably damaging Het
Pard3b T A 1: 62,637,867 Y1186N probably damaging Het
Pcca A G 14: 122,557,711 probably benign Het
Plekha8 A G 6: 54,615,555 probably benign Het
Ptpn14 T A 1: 189,822,675 L144* probably null Het
Rad52 C T 6: 119,913,080 R56C probably damaging Het
Rdx C T 9: 52,086,453 R576C probably damaging Het
Rnf135 C T 11: 80,184,131 T72I probably benign Het
Robo4 G T 9: 37,403,305 R196L probably benign Het
Rsf1 G GACGTCGGCT 7: 97,579,909 probably benign Het
Rsf1 A T 7: 97,678,964 I1058F Het
Ryr2 A T 13: 11,785,104 V919E probably damaging Het
Slc39a6 A T 18: 24,596,329 Y442* probably null Het
Slc4a11 T G 2: 130,687,220 S437R probably damaging Het
Slc7a6 T A 8: 106,195,902 V440E probably damaging Het
Sox2 A T 3: 34,650,980 N189Y possibly damaging Het
Spata13 A T 14: 60,756,581 M1161L probably benign Het
Spock3 T A 8: 62,951,952 Y51* probably null Het
Sptbn1 A G 11: 30,117,800 Y1805H probably benign Het
Tcerg1l C T 7: 138,397,531 W41* probably null Het
Tdrd9 A G 12: 112,013,284 Y401C probably benign Het
Tex47 A T 5: 7,305,115 I99F probably damaging Het
Tlr9 G A 9: 106,222,635 probably benign Het
Tmem209 T A 6: 30,497,943 S276C possibly damaging Het
Tmprss11f A C 5: 86,539,759 S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,046,841 probably benign Het
Ttc7 T A 17: 87,330,092 M425K probably damaging Het
Ttn C T 2: 76,909,122 G3737D unknown Het
Unc13b A T 4: 43,176,484 R2437S unknown Het
Vmn1r128 A G 7: 21,349,815 Y148C possibly damaging Het
Vmn1r193 T C 13: 22,219,669 Y51C probably benign Het
Vmn2r112 A G 17: 22,618,631 Y691C probably damaging Het
Vmn2r25 T A 6: 123,823,610 D591V probably damaging Het
Vmn2r94 A G 17: 18,244,073 S652P possibly damaging Het
Vps50 T A 6: 3,536,967 C313S probably damaging Het
Vwa5b1 A G 4: 138,610,730 V93A probably benign Het
Xrcc5 T G 1: 72,343,031 D455E possibly damaging Het
Zdhhc6 T A 19: 55,302,555 probably benign Het
Zfp964 G A 8: 69,663,755 G335D probably damaging Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108947861 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108947405 missense probably benign
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R6598:Uqcrc1 UTSW 9 108947622 missense possibly damaging 0.93
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
R8708:Uqcrc1 UTSW 9 108947040 missense probably damaging 0.97
R8892:Uqcrc1 UTSW 9 108937118 missense probably damaging 1.00
R8975:Uqcrc1 UTSW 9 108947653 missense probably damaging 1.00
R9136:Uqcrc1 UTSW 9 108947905 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTCGTACACAGATGAGGAGCAG -3'
(R):5'- GTCAGGTACAGGGATAAGCC -3'

Sequencing Primer
(F):5'- ATGAGGAGCAGGCTGTCTC -3'
(R):5'- GATAAGCCCCGGCAGTAAGC -3'
Posted On 2021-08-02