Incidental Mutation 'R8889:Ap3b1'
ID 677586
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 068693-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R8889 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 94679348 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 997 (V997M)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect unknown
Transcript: ENSMUST00000022196
AA Change: V997M
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: V997M

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Predicted Effect
Meta Mutation Damage Score 0.1071 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,815,606 (GRCm39) L285I probably damaging Het
Abcc2 T G 19: 43,795,571 (GRCm39) S442R possibly damaging Het
Adgrl3 A T 5: 81,874,516 (GRCm39) I938F probably damaging Het
Ank1 T C 8: 23,606,990 (GRCm39) L1297P probably damaging Het
Ash2l T C 8: 26,313,247 (GRCm39) K413R probably benign Het
Cacnb1 A T 11: 97,901,192 (GRCm39) V220E probably damaging Het
Cacul1 A T 19: 60,568,960 (GRCm39) L66Q probably damaging Het
Camkv C T 9: 107,823,333 (GRCm39) R120* probably null Het
Ccny T G 18: 9,345,235 (GRCm39) S180R probably damaging Het
Cdh23 G T 10: 60,143,284 (GRCm39) H3012Q probably damaging Het
Clasp2 T A 9: 113,709,251 (GRCm39) L680Q probably damaging Het
Clip1 A T 5: 123,717,565 (GRCm39) S1241R probably benign Het
Cthrc1 T A 15: 38,940,445 (GRCm39) L16H probably damaging Het
Ctnna1 G A 18: 35,372,586 (GRCm39) V514I possibly damaging Het
Ddr1 A C 17: 35,993,556 (GRCm39) I852S probably benign Het
Echs1 A C 7: 139,688,031 (GRCm39) L258R probably damaging Het
Epha8 G T 4: 136,661,850 (GRCm39) H582N probably benign Het
Exph5 G T 9: 53,287,955 (GRCm39) G1679W probably damaging Het
Fhod3 G A 18: 25,189,452 (GRCm39) probably null Het
Gm10803 G A 2: 93,394,281 (GRCm39) D18N unknown Het
Gpr152 T A 19: 4,192,723 (GRCm39) I88N probably damaging Het
Gpr179 T C 11: 97,226,590 (GRCm39) D1855G possibly damaging Het
H2al2a T A 2: 18,001,599 (GRCm39) D29V probably damaging Het
Hnrnpf T G 6: 117,901,753 (GRCm39) S346A probably benign Het
Hsd11b2 C T 8: 106,249,263 (GRCm39) R213C probably damaging Het
Il17rd A G 14: 26,821,930 (GRCm39) D552G possibly damaging Het
Ipo9 T C 1: 135,314,544 (GRCm39) N904S possibly damaging Het
Klhl14 T G 18: 21,691,220 (GRCm39) T437P possibly damaging Het
Krt5 T C 15: 101,619,185 (GRCm39) M268V probably benign Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Ltn1 A T 16: 87,229,230 (GRCm39) probably benign Het
Macf1 A G 4: 123,249,036 (GRCm39) L7165P probably damaging Het
Micall2 T A 5: 139,703,254 (GRCm39) H194L probably damaging Het
Mmp16 T A 4: 18,051,820 (GRCm39) Y270N probably damaging Het
Nme6 T G 9: 109,668,706 (GRCm39) F41V probably damaging Het
Npffr1 A G 10: 61,449,939 (GRCm39) N71S possibly damaging Het
Or1p4-ps1 T C 11: 74,207,949 (GRCm39) W33R probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Pard3b T A 1: 62,677,026 (GRCm39) Y1186N probably damaging Het
Pate5 T A 9: 35,750,682 (GRCm39) T47S probably damaging Het
Pcca A G 14: 122,795,123 (GRCm39) probably benign Het
Plekha8 A G 6: 54,592,540 (GRCm39) probably benign Het
Ptpn14 T A 1: 189,554,872 (GRCm39) L144* probably null Het
Rad52 C T 6: 119,890,041 (GRCm39) R56C probably damaging Het
Rdx C T 9: 51,997,753 (GRCm39) R576C probably damaging Het
Rnf135 C T 11: 80,074,957 (GRCm39) T72I probably benign Het
Robo4 G T 9: 37,314,601 (GRCm39) R196L probably benign Het
Rsf1 G GACGTCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Rsf1 A T 7: 97,328,171 (GRCm39) I1058F Het
Ryr2 A T 13: 11,799,990 (GRCm39) V919E probably damaging Het
Slc39a6 A T 18: 24,729,386 (GRCm39) Y442* probably null Het
Slc4a11 T G 2: 130,529,140 (GRCm39) S437R probably damaging Het
Slc7a6 T A 8: 106,922,534 (GRCm39) V440E probably damaging Het
Sox2 A T 3: 34,705,129 (GRCm39) N189Y possibly damaging Het
Spata13 A T 14: 60,994,030 (GRCm39) M1161L probably benign Het
Spock3 T A 8: 63,404,986 (GRCm39) Y51* probably null Het
Sptbn1 A G 11: 30,067,800 (GRCm39) Y1805H probably benign Het
Tcerg1l C T 7: 137,999,260 (GRCm39) W41* probably null Het
Tdrd9 A G 12: 111,979,718 (GRCm39) Y401C probably benign Het
Tex47 A T 5: 7,355,115 (GRCm39) I99F probably damaging Het
Tlr9 G A 9: 106,099,834 (GRCm39) probably benign Het
Tmem209 T A 6: 30,497,942 (GRCm39) S276C possibly damaging Het
Tmprss11f A C 5: 86,687,618 (GRCm39) S97A possibly damaging Het
Tnfaip8 ACACACTC AC 18: 50,179,908 (GRCm39) probably benign Het
Ttc7 T A 17: 87,637,520 (GRCm39) M425K probably damaging Het
Ttn C T 2: 76,739,466 (GRCm39) G3737D unknown Het
Unc13b A T 4: 43,176,484 (GRCm39) R2437S unknown Het
Uqcrc1 C T 9: 108,766,186 (GRCm39) R58C probably damaging Het
Vmn1r128 A G 7: 21,083,740 (GRCm39) Y148C possibly damaging Het
Vmn1r193 T C 13: 22,403,839 (GRCm39) Y51C probably benign Het
Vmn2r112 A G 17: 22,837,612 (GRCm39) Y691C probably damaging Het
Vmn2r25 T A 6: 123,800,569 (GRCm39) D591V probably damaging Het
Vmn2r94 A G 17: 18,464,335 (GRCm39) S652P possibly damaging Het
Vps50 T A 6: 3,536,967 (GRCm39) C313S probably damaging Het
Vwa5b1 A G 4: 138,338,041 (GRCm39) V93A probably benign Het
Xrcc5 T G 1: 72,382,190 (GRCm39) D455E possibly damaging Het
Zdhhc6 T A 19: 55,290,987 (GRCm39) probably benign Het
Zfp964 G A 8: 70,116,405 (GRCm39) G335D probably damaging Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0346:Ap3b1 UTSW 13 94,582,479 (GRCm39) nonsense probably null
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCCTCGGGCTCTTACAG -3'
(R):5'- TATGAGGGCACGCACTAGAG -3'

Sequencing Primer
(F):5'- AGCAGTGCAAGCTGTAGCC -3'
(R):5'- CACGCACTAGAGAAAATGGGC -3'
Posted On 2021-08-02