Incidental Mutation 'R8890:Olfr16'
ID677608
Institutional Source Beutler Lab
Gene Symbol Olfr16
Ensembl Gene ENSMUSG00000037924
Gene Nameolfactory receptor 16
SynonymsMOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R8890 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location172950409-172958357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 172957478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 228 (V228M)
Ref Sequence ENSEMBL: ENSMUSP00000149249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038432] [ENSMUST00000215254]
Predicted Effect probably benign
Transcript: ENSMUST00000038432
AA Change: V228M

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041524
Gene: ENSMUSG00000037924
AA Change: V228M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.5e-51 PFAM
Pfam:7tm_1 41 289 3.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215254
AA Change: V228M

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
Acrv1 A T 9: 36,693,312 M1L probably benign Het
Adam23 G A 1: 63,585,365 G784D possibly damaging Het
Astl A T 2: 127,356,559 M365L probably benign Het
C1ql3 T A 2: 13,010,373 T159S Het
Ccser2 T G 14: 36,879,395 D344A probably damaging Het
Cox11 A C 11: 90,643,773 I214L probably damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Ctsq T A 13: 61,037,688 Y213F probably damaging Het
Cyp2j5 T A 4: 96,634,318 I340F probably damaging Het
Efcab6 A G 15: 83,945,148 F664L probably damaging Het
Eif3j2 A G 18: 43,477,211 L179P probably benign Het
Fam109b G T 15: 82,343,417 V46F probably damaging Het
Fhad1 A T 4: 141,929,591 M84K probably benign Het
Gabbr1 T C 17: 37,047,544 V58A probably benign Het
Gabra1 T A 11: 42,133,726 Y374F probably benign Het
Glt28d2 A T 3: 85,872,052 V38D possibly damaging Het
Gm13101 G T 4: 143,964,924 Q410K probably benign Het
Grid2 A T 6: 63,256,939 H28L probably benign Het
Hat1 G A 2: 71,438,793 R355K probably damaging Het
Hivep3 T C 4: 120,096,460 Y658H possibly damaging Het
Hsh2d T C 8: 72,197,846 F108S probably damaging Het
Il17rc G T 6: 113,479,070 C292F probably damaging Het
Il31ra T C 13: 112,524,327 D576G possibly damaging Het
Iqsec3 T C 6: 121,412,556 D652G probably damaging Het
Kdm5a T A 6: 120,389,663 S420R probably damaging Het
Klhdc7b A G 15: 89,388,685 T599A probably benign Het
Lrrc8c A T 5: 105,607,088 E243V probably damaging Het
Mecom A G 3: 29,952,733 S714P probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mipep G T 14: 60,872,057 A628S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mterf3 C T 13: 66,916,612 probably null Het
Myh15 C A 16: 49,138,767 L1001I probably damaging Het
Myom3 G A 4: 135,814,254 M1385I probably benign Het
Nphs1 C T 7: 30,462,655 R270W probably damaging Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Olfr1130 A T 2: 87,608,068 I227F probably damaging Het
Olfr569 A T 7: 102,887,492 Y220* probably null Het
Olfr629 G T 7: 103,740,468 F257L probably damaging Het
Pcdh7 A T 5: 57,719,375 I91F probably damaging Het
Piezo1 T C 8: 122,489,591 R1394G Het
Psmd1 G A 1: 86,085,192 R361Q probably damaging Het
Ralb G A 1: 119,483,516 T31M probably damaging Het
Rassf4 T A 6: 116,640,344 K233N probably damaging Het
Rif1 T C 2: 52,098,863 F756S probably damaging Het
Rpgrip1 G A 14: 52,145,044 D556N possibly damaging Het
Scfd1 A G 12: 51,427,895 T478A probably benign Het
Spag17 T A 3: 100,004,678 I288N possibly damaging Het
Sult1e1 C T 5: 87,579,860 V188I probably benign Het
Tmco1 A G 1: 167,316,245 R82G Het
Tmem109 T C 19: 10,871,871 S207G probably benign Het
Whamm A G 7: 81,593,892 T621A probably benign Het
Zbtb40 A G 4: 136,998,586 L554P probably damaging Het
Zfp131 A T 13: 119,782,802 M114K probably damaging Het
Zfp532 C T 18: 65,624,333 P446S probably damaging Het
Other mutations in Olfr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr16 APN 1 172957591 missense possibly damaging 0.66
IGL00336:Olfr16 APN 1 172957478 missense probably benign 0.30
IGL01155:Olfr16 APN 1 172956924 missense probably benign 0.43
IGL01549:Olfr16 APN 1 172956974 missense probably damaging 1.00
IGL02679:Olfr16 APN 1 172957176 missense probably damaging 1.00
IGL03071:Olfr16 APN 1 172956935 missense probably benign 0.01
IGL03352:Olfr16 APN 1 172957283 missense probably benign 0.00
R0449:Olfr16 UTSW 1 172957398 missense probably damaging 1.00
R1725:Olfr16 UTSW 1 172957341 missense possibly damaging 0.90
R1726:Olfr16 UTSW 1 172957091 missense probably benign 0.00
R1735:Olfr16 UTSW 1 172956807 missense probably benign
R1928:Olfr16 UTSW 1 172957314 missense probably damaging 0.98
R4258:Olfr16 UTSW 1 172957638 missense possibly damaging 0.88
R4359:Olfr16 UTSW 1 172957080 missense probably benign
R4434:Olfr16 UTSW 1 172957544 missense probably damaging 1.00
R4666:Olfr16 UTSW 1 172957590 missense probably benign
R4874:Olfr16 UTSW 1 172957599 missense probably benign 0.00
R5063:Olfr16 UTSW 1 172957442 missense possibly damaging 0.48
R5988:Olfr16 UTSW 1 172957156 nonsense probably null
R6074:Olfr16 UTSW 1 172957378 missense probably benign 0.10
R7021:Olfr16 UTSW 1 172956927 missense probably benign 0.01
R7234:Olfr16 UTSW 1 172957106 missense probably damaging 0.96
R7527:Olfr16 UTSW 1 172956944 missense probably benign 0.00
R8271:Olfr16 UTSW 1 172957177 nonsense probably null
R8906:Olfr16 UTSW 1 172956619 start gained probably benign
Z1088:Olfr16 UTSW 1 172957324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGCCATGTTCCATTTGC -3'
(R):5'- GTTCCTGAGGCTGTAGACAAC -3'

Sequencing Primer
(F):5'- GCCCTTTTGTGGCACGG -3'
(R):5'- TGTAGACAACAGGGTTCAGC -3'
Posted On2021-08-02