Incidental Mutation 'R8890:Nphs1'
ID 677632
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8890 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 30462655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 270 (R270W)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: R270W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: R270W

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: R256W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: R256W

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
Acrv1 A T 9: 36,693,312 M1L probably benign Het
Adam23 G A 1: 63,585,365 G784D possibly damaging Het
Astl A T 2: 127,356,559 M365L probably benign Het
C1ql3 T A 2: 13,010,373 T159S Het
Ccser2 T G 14: 36,879,395 D344A probably damaging Het
Cox11 A C 11: 90,643,773 I214L probably damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Ctsq T A 13: 61,037,688 Y213F probably damaging Het
Cyp2j5 T A 4: 96,634,318 I340F probably damaging Het
Efcab6 A G 15: 83,945,148 F664L probably damaging Het
Eif3j2 A G 18: 43,477,211 L179P probably benign Het
Fam109b G T 15: 82,343,417 V46F probably damaging Het
Fhad1 A T 4: 141,929,591 M84K probably benign Het
Gabbr1 T C 17: 37,047,544 V58A probably benign Het
Gabra1 T A 11: 42,133,726 Y374F probably benign Het
Glt28d2 A T 3: 85,872,052 V38D possibly damaging Het
Gm13101 G T 4: 143,964,924 Q410K probably benign Het
Grid2 A T 6: 63,256,939 H28L probably benign Het
Hat1 G A 2: 71,438,793 R355K probably damaging Het
Hivep3 T C 4: 120,096,460 Y658H possibly damaging Het
Hsh2d T C 8: 72,197,846 F108S probably damaging Het
Il17rc G T 6: 113,479,070 C292F probably damaging Het
Il31ra T C 13: 112,524,327 D576G possibly damaging Het
Iqsec3 T C 6: 121,412,556 D652G probably damaging Het
Kdm5a T A 6: 120,389,663 S420R probably damaging Het
Klhdc7b A G 15: 89,388,685 T599A probably benign Het
Lrrc8c A T 5: 105,607,088 E243V probably damaging Het
Mecom A G 3: 29,952,733 S714P probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mipep G T 14: 60,872,057 A628S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mterf3 C T 13: 66,916,612 probably null Het
Myh15 C A 16: 49,138,767 L1001I probably damaging Het
Myom3 G A 4: 135,814,254 M1385I probably benign Het
Nbea T C 3: 56,019,363 probably benign Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Olfr1130 A T 2: 87,608,068 I227F probably damaging Het
Olfr16 G A 1: 172,957,478 V228M probably benign Het
Olfr569 A T 7: 102,887,492 Y220* probably null Het
Olfr629 G T 7: 103,740,468 F257L probably damaging Het
Pcdh7 A T 5: 57,719,375 I91F probably damaging Het
Piezo1 T C 8: 122,489,591 R1394G Het
Psmd1 G A 1: 86,085,192 R361Q probably damaging Het
Ralb G A 1: 119,483,516 T31M probably damaging Het
Rassf4 T A 6: 116,640,344 K233N probably damaging Het
Rif1 T C 2: 52,098,863 F756S probably damaging Het
Rpgrip1 G A 14: 52,145,044 D556N possibly damaging Het
Scai T C 2: 39,150,388 probably benign Het
Scfd1 A G 12: 51,427,895 T478A probably benign Het
Spag17 T A 3: 100,004,678 I288N possibly damaging Het
Sult1e1 C T 5: 87,579,860 V188I probably benign Het
Tmco1 A G 1: 167,316,245 R82G Het
Tmem109 T C 19: 10,871,871 S207G probably benign Het
Vmn2r115 A G 17: 23,359,523 T657A probably damaging Het
Whamm A G 7: 81,593,892 T621A probably benign Het
Zbtb40 A G 4: 136,998,586 L554P probably damaging Het
Zfp131 A T 13: 119,782,802 M114K probably damaging Het
Zfp532 C T 18: 65,624,333 P446S probably damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R7767:Nphs1 UTSW 7 30463308 missense probably damaging 1.00
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGTCCTTGCAAAGTGGAC -3'
(R):5'- AGCTATGGACACTGGTTTACCATTC -3'

Sequencing Primer
(F):5'- CCTTGCAAAGTGGACTTGAAGTC -3'
(R):5'- GGTTTACCATTCTGGACACAATGC -3'
Posted On 2021-08-02