Incidental Mutation 'R8890:Ctsq'
ID 677644
Institutional Source Beutler Lab
Gene Symbol Ctsq
Ensembl Gene ENSMUSG00000021439
Gene Name cathepsin Q
Synonyms 1600010J02Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029636.3; MGI:2137385

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8890 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 61035024-61040631 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61037688 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 213 (Y213F)
Ref Sequence ENSEMBL: ENSMUSP00000021888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021888]
AlphaFold Q91ZF4
Predicted Effect probably damaging
Transcript: ENSMUST00000021888
AA Change: Y213F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021888
Gene: ENSMUSG00000021439
AA Change: Y213F

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.76e-24 SMART
Pept_C1 125 342 3.46e-103 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
Acrv1 A T 9: 36,693,312 M1L probably benign Het
Adam23 G A 1: 63,585,365 G784D possibly damaging Het
Astl A T 2: 127,356,559 M365L probably benign Het
C1ql3 T A 2: 13,010,373 T159S Het
Ccser2 T G 14: 36,879,395 D344A probably damaging Het
Cox11 A C 11: 90,643,773 I214L probably damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Cyp2j5 T A 4: 96,634,318 I340F probably damaging Het
Efcab6 A G 15: 83,945,148 F664L probably damaging Het
Eif3j2 A G 18: 43,477,211 L179P probably benign Het
Fam109b G T 15: 82,343,417 V46F probably damaging Het
Fhad1 A T 4: 141,929,591 M84K probably benign Het
Gabbr1 T C 17: 37,047,544 V58A probably benign Het
Gabra1 T A 11: 42,133,726 Y374F probably benign Het
Glt28d2 A T 3: 85,872,052 V38D possibly damaging Het
Gm13101 G T 4: 143,964,924 Q410K probably benign Het
Grid2 A T 6: 63,256,939 H28L probably benign Het
Hat1 G A 2: 71,438,793 R355K probably damaging Het
Hivep3 T C 4: 120,096,460 Y658H possibly damaging Het
Hsh2d T C 8: 72,197,846 F108S probably damaging Het
Il17rc G T 6: 113,479,070 C292F probably damaging Het
Il31ra T C 13: 112,524,327 D576G possibly damaging Het
Iqsec3 T C 6: 121,412,556 D652G probably damaging Het
Kdm5a T A 6: 120,389,663 S420R probably damaging Het
Klhdc7b A G 15: 89,388,685 T599A probably benign Het
Lrrc8c A T 5: 105,607,088 E243V probably damaging Het
Mecom A G 3: 29,952,733 S714P probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mipep G T 14: 60,872,057 A628S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mterf3 C T 13: 66,916,612 probably null Het
Myh15 C A 16: 49,138,767 L1001I probably damaging Het
Myom3 G A 4: 135,814,254 M1385I probably benign Het
Nbea T C 3: 56,019,363 probably benign Het
Nphs1 C T 7: 30,462,655 R270W probably damaging Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Olfr1130 A T 2: 87,608,068 I227F probably damaging Het
Olfr16 G A 1: 172,957,478 V228M probably benign Het
Olfr569 A T 7: 102,887,492 Y220* probably null Het
Olfr629 G T 7: 103,740,468 F257L probably damaging Het
Pcdh7 A T 5: 57,719,375 I91F probably damaging Het
Piezo1 T C 8: 122,489,591 R1394G Het
Psmd1 G A 1: 86,085,192 R361Q probably damaging Het
Ralb G A 1: 119,483,516 T31M probably damaging Het
Rassf4 T A 6: 116,640,344 K233N probably damaging Het
Rif1 T C 2: 52,098,863 F756S probably damaging Het
Rpgrip1 G A 14: 52,145,044 D556N possibly damaging Het
Scai T C 2: 39,150,388 probably benign Het
Scfd1 A G 12: 51,427,895 T478A probably benign Het
Spag17 T A 3: 100,004,678 I288N possibly damaging Het
Sult1e1 C T 5: 87,579,860 V188I probably benign Het
Tmco1 A G 1: 167,316,245 R82G Het
Tmem109 T C 19: 10,871,871 S207G probably benign Het
Vmn2r115 A G 17: 23,359,523 T657A probably damaging Het
Whamm A G 7: 81,593,892 T621A probably benign Het
Zbtb40 A G 4: 136,998,586 L554P probably damaging Het
Zfp131 A T 13: 119,782,802 M114K probably damaging Het
Zfp532 C T 18: 65,624,333 P446S probably damaging Het
Other mutations in Ctsq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ctsq APN 13 61037714 missense probably damaging 0.96
IGL00585:Ctsq APN 13 61037127 missense probably benign 0.00
IGL00743:Ctsq APN 13 61036184 missense probably damaging 1.00
IGL00897:Ctsq APN 13 61037725 missense probably damaging 1.00
IGL01679:Ctsq APN 13 61038908 missense probably benign 0.00
IGL01982:Ctsq APN 13 61038918 missense probably benign
IGL01982:Ctsq APN 13 61039521 missense probably benign 0.05
IGL02448:Ctsq APN 13 61036230 missense probably damaging 1.00
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0036:Ctsq UTSW 13 61037671 critical splice donor site probably null
R0741:Ctsq UTSW 13 61036205 missense probably damaging 0.99
R1192:Ctsq UTSW 13 61039045 missense probably damaging 1.00
R1593:Ctsq UTSW 13 61036172 splice site probably null
R3906:Ctsq UTSW 13 61038771 missense probably damaging 1.00
R4483:Ctsq UTSW 13 61038912 missense probably benign 0.01
R4590:Ctsq UTSW 13 61036214 missense probably benign 0.17
R5157:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5365:Ctsq UTSW 13 61037818 missense possibly damaging 0.95
R5366:Ctsq UTSW 13 61037099 missense probably benign 0.00
R5546:Ctsq UTSW 13 61037888 nonsense probably null
R5595:Ctsq UTSW 13 61037060 missense probably benign 0.41
R6046:Ctsq UTSW 13 61039141 missense probably benign 0.00
R6049:Ctsq UTSW 13 61038758 critical splice donor site probably null
R6535:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R6537:Ctsq UTSW 13 61035326 missense probably damaging 1.00
R7159:Ctsq UTSW 13 61038923 missense probably benign 0.00
R8189:Ctsq UTSW 13 61037155 missense probably damaging 1.00
Z1176:Ctsq UTSW 13 61037123 missense probably benign 0.01
Z1177:Ctsq UTSW 13 61037096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCATACTGATACTTTCACGCC -3'
(R):5'- TATGGACCTATCAACTGCCATTTTC -3'

Sequencing Primer
(F):5'- TACTGATACTTTCACGCCAAAATC -3'
(R):5'- CCTGTGACTGGTGCCATAGAAG -3'
Posted On 2021-08-02