Incidental Mutation 'R8890:4930567H17Rik'
ID 677660
Institutional Source Beutler Lab
Gene Symbol 4930567H17Rik
Ensembl Gene ENSMUSG00000073141
Gene Name RIKEN cDNA 4930567H17 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8890 (G1)
Quality Score 221.999
Status Validated
Chromosome X
Chromosomal Location 70393901-70394740 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70394388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 100 (R100W)
Ref Sequence ENSEMBL: ENSMUSP00000090060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053981] [ENSMUST00000092405]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053981
SMART Domains Protein: ENSMUSP00000052765
Gene: ENSMUSG00000045237

DomainStartEndE-ValueType
ASCH 6 114 3.72e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092405
AA Change: R100W

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090060
Gene: ENSMUSG00000073141
AA Change: R100W

DomainStartEndE-ValueType
SCOP:d1sig__ 115 223 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 A T 9: 36,693,312 M1L probably benign Het
Adam23 G A 1: 63,585,365 G784D possibly damaging Het
Astl A T 2: 127,356,559 M365L probably benign Het
C1ql3 T A 2: 13,010,373 T159S Het
Ccser2 T G 14: 36,879,395 D344A probably damaging Het
Cox11 A C 11: 90,643,773 I214L probably damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Ctsq T A 13: 61,037,688 Y213F probably damaging Het
Cyp2j5 T A 4: 96,634,318 I340F probably damaging Het
Efcab6 A G 15: 83,945,148 F664L probably damaging Het
Eif3j2 A G 18: 43,477,211 L179P probably benign Het
Fam109b G T 15: 82,343,417 V46F probably damaging Het
Fhad1 A T 4: 141,929,591 M84K probably benign Het
Gabbr1 T C 17: 37,047,544 V58A probably benign Het
Gabra1 T A 11: 42,133,726 Y374F probably benign Het
Glt28d2 A T 3: 85,872,052 V38D possibly damaging Het
Gm13101 G T 4: 143,964,924 Q410K probably benign Het
Grid2 A T 6: 63,256,939 H28L probably benign Het
Hat1 G A 2: 71,438,793 R355K probably damaging Het
Hivep3 T C 4: 120,096,460 Y658H possibly damaging Het
Hsh2d T C 8: 72,197,846 F108S probably damaging Het
Il17rc G T 6: 113,479,070 C292F probably damaging Het
Il31ra T C 13: 112,524,327 D576G possibly damaging Het
Iqsec3 T C 6: 121,412,556 D652G probably damaging Het
Kdm5a T A 6: 120,389,663 S420R probably damaging Het
Klhdc7b A G 15: 89,388,685 T599A probably benign Het
Lrrc8c A T 5: 105,607,088 E243V probably damaging Het
Mecom A G 3: 29,952,733 S714P probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mipep G T 14: 60,872,057 A628S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mterf3 C T 13: 66,916,612 probably null Het
Myh15 C A 16: 49,138,767 L1001I probably damaging Het
Myom3 G A 4: 135,814,254 M1385I probably benign Het
Nbea T C 3: 56,019,363 probably benign Het
Nphs1 C T 7: 30,462,655 R270W probably damaging Het
Nwd1 T A 8: 72,711,856 S1552T probably benign Het
Olfr1130 A T 2: 87,608,068 I227F probably damaging Het
Olfr16 G A 1: 172,957,478 V228M probably benign Het
Olfr569 A T 7: 102,887,492 Y220* probably null Het
Olfr629 G T 7: 103,740,468 F257L probably damaging Het
Pcdh7 A T 5: 57,719,375 I91F probably damaging Het
Piezo1 T C 8: 122,489,591 R1394G Het
Psmd1 G A 1: 86,085,192 R361Q probably damaging Het
Ralb G A 1: 119,483,516 T31M probably damaging Het
Rassf4 T A 6: 116,640,344 K233N probably damaging Het
Rif1 T C 2: 52,098,863 F756S probably damaging Het
Rpgrip1 G A 14: 52,145,044 D556N possibly damaging Het
Scai T C 2: 39,150,388 probably benign Het
Scfd1 A G 12: 51,427,895 T478A probably benign Het
Spag17 T A 3: 100,004,678 I288N possibly damaging Het
Sult1e1 C T 5: 87,579,860 V188I probably benign Het
Tmco1 A G 1: 167,316,245 R82G Het
Tmem109 T C 19: 10,871,871 S207G probably benign Het
Vmn2r115 A G 17: 23,359,523 T657A probably damaging Het
Whamm A G 7: 81,593,892 T621A probably benign Het
Zbtb40 A G 4: 136,998,586 L554P probably damaging Het
Zfp131 A T 13: 119,782,802 M114K probably damaging Het
Zfp532 C T 18: 65,624,333 P446S probably damaging Het
Other mutations in 4930567H17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:4930567H17Rik UTSW X 70394207 unclassified probably benign
R2257:4930567H17Rik UTSW X 70394406 missense probably damaging 1.00
R3919:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3939:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3940:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4231:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4232:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4234:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4235:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4236:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R8139:4930567H17Rik UTSW X 70394514 missense possibly damaging 0.89
R8895:4930567H17Rik UTSW X 70394388 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACAGTTGTTTTCCGTGTAATGATCA -3'
(R):5'- CATGGAAGACGGCATCACAC -3'

Sequencing Primer
(F):5'- CCGTGTAATGATCATCATCGTC -3'
(R):5'- GGGCCTCTGAGACCACATAAAAG -3'
Posted On 2021-08-02